If you can read this, either the style sheet didn't load or you have an older browser that doesn't support style sheets. Try clearing your browser cache and refreshing the page.

(WFAA Fort Worth)   After spending $500,000 in research, the Sasquatch Genome Project claims to have definitive DNA and video proof that Bigfoot is real. (100% convincing video clips included)   (wfaa.com) divider line 137
    More: Unlikely, Sasquatch Genome Project, Bigfoot, DNA  
•       •       •

8724 clicks; posted to Main » on 01 Oct 2013 at 8:16 PM (41 weeks ago)   |  Favorite    |   share:  Share on Twitter share via Email Share on Facebook   more»



137 Comments   (+0 »)
   
View Voting Results: Smartest and Funniest

First | « | 1 | 2 | 3 | » | Last | Show all
 
2013-10-01 07:55:04 PM
Bunk! Bunk, I say! Bring me a bag full of Bigfoot's droppings or shut up!
 
2013-10-01 08:05:43 PM
TOP QUALITY EXERCYCLE FOR SALE!
 
2013-10-01 08:17:14 PM
And you can order the DVD "proof" for just $29.95
 
2013-10-01 08:17:46 PM
I'd like to read TFA, but it's all blurry and pixelated.
 
2013-10-01 08:20:03 PM

Dow Jones and the Temple of Doom: And you can order the DVD "proof" for just $29.95


AND you can get your teeth whitened, your aura massaged, AND your depression cured by 44.4938%!!!
 
2013-10-01 08:20:18 PM
I'll file it next to my 100% true and totally not faked Alien Autopsy video.
 
2013-10-01 08:21:43 PM

fusillade762: Bunk! Bunk, I say! Bring me a bag full of Bigfoot's droppings or shut up!


I think we've had this conversation before.

If that's the evidence required; then, how do I know that you exsist?
 
2013-10-01 08:22:24 PM
They claim to have DNA "proof."  OK, show it then, don't act all mysterious.  If your goal is to be taken seriously, lead with your strongest evidence, not some grainy home movies of someone in a crappy Chewbacca costume.  Please, show me, I'll wait.
 
2013-10-01 08:23:23 PM

devildog123: They claim to have DNA "proof."  OK, show it then, don't act all mysterious.  If your goal is to be taken seriously, lead with your strongest evidence, not some grainy home movies of someone in a crappy Chewbacca costume.  Please, show me, I'll wait.


This.
 
2013-10-01 08:23:45 PM
One of the Discovery networks will pay 10's of millions for the documentary.
 
2013-10-01 08:25:20 PM

devildog123: They claim to have DNA "proof."  OK, show it then, don't act all mysterious.  If your goal is to be taken seriously, lead with your strongest evidence, not some grainy home movies of someone in a crappy Chewbacca costume.  Please, show me, I'll wait.


I'm calling BS also, someone in the south would've shoot that damn thing.
 
2013-10-01 08:26:08 PM
Bigfoot is an orthodontist? Oh wait......you want to be taken seriously but decide to put an ad in front of your video evidence? Fark you.
 
2013-10-01 08:27:51 PM
And what, pray tell, did the bigfoot evolve from? We are the only ape species to ever colonize the New World. Until you can show me a lineage you're just blowing smoke up my ass.
 
2013-10-01 08:28:15 PM

fusillade762: Bunk! Bunk, I say! Bring me a bag full of Bigfoot's droppings or shut up!


I might be able to get some, but it'll cost 'ya


s3.amazonaws.com

/that's a big foot on that Shaquatch
 
2013-10-01 08:28:45 PM

xanadian: I'd like to read TFA, but it's all blurry and pixelated.


I think Bigfoot is blurry, that's the problem. It's not the photographer's fault. Bigfoot is blurry, and that's extra scary to me. There's a large, out-of-focus monster roaming the countryside. Run, he's fuzzy, get out of here.


iheartscotch: fusillade762: Bunk! Bunk, I say! Bring me a bag full of Bigfoot's droppings or shut up!

I think we've had this conversation before.

If that's the evidence required; then, how do I know that you exsist?


Give me your address, I'll mail you some poop.
 
2013-10-01 08:32:01 PM
And if you believe this, I have a bridge in New York I'll sell you dirt cheap. I'm also looking to move money out of Nigeria.
 
2013-10-01 08:32:21 PM
I thought Sasquatch was working under an exclusive contract with Jack Link's.
 
2013-10-01 08:32:44 PM
There's an awesome bigfoot museum in a trailer just outside Santa Cruz, run by an aging hippie. We take visitors up there because it's a great WTF spot. The guy is seriously into bigfoot, it's worth stopping in just for the conversation.
 
2013-10-01 08:33:06 PM
Had to Google the name, just to make sure, and yeah, it's that nutter again.

"Now let me address the purported legitimacy of her study. Scientific studies are published in peer-reviewed journals. Ketchum's study was published in DeNovo Scientific Journal, which appears to not have existed a couple of weeks before she published her findings in February. Moreover, since then the journal appears to not have published a single additional paper. So what we have is a journal created for the single purpose of publishing and selling copies of Ketchum's "scientific article" for $30." [Link]
 
2013-10-01 08:33:16 PM
So, since they've obtained proof, I suppose that means they don't need any more funding...
 
2013-10-01 08:33:18 PM

fusillade762: iheartscotch: fusillade762: Bunk! Bunk, I say! Bring me a bag full of Bigfoot's droppings or shut up!

I think we've had this conversation before.

If that's the evidence required; then, how do I know that you exsist?

Give me your address, I'll mail you some poop.


Be sure to put delivery instructions on the package:  "Please light on fire upon delivery."
 
2013-10-01 08:34:32 PM
That's it! They convinced me! I finally believe!
 
2013-10-01 08:34:50 PM
It would suck if that 500,000 had gone to the human genome project.
 
2013-10-01 08:35:51 PM
Bigfoot hides its bones better than any other animal on this planet.

//hehe, "hide the bone"
 
2013-10-01 08:37:00 PM
TFA: The group - led by Dr. Melba Ketchum, a trained veterinarian...

Those are the best kind of veterinarians...

TFA:   "This was a serious study," Ketchum said...

www.seriouscat.com
 
2013-10-01 08:39:16 PM
Nope it is just Aunt Bunny
 
2013-10-01 08:40:10 PM
This is a case where peer-reviewed and independently verified science would be needed.
 
2013-10-01 08:45:06 PM
Well, they ain't gonna spend $500,000 and say that bigfoot does not exist.
 
2013-10-01 08:45:23 PM
 It's made with bits of real Bigfoot, so you know it's good. They've done studies, you know.
 
2013-10-01 08:45:28 PM

fusillade762: xanadian: I'd like to read TFA, but it's all blurry and pixelated.

I think Bigfoot is blurry, that's the problem. It's not the photographer's fault. Bigfoot is blurry, and that's extra scary to me. There's a large, out-of-focus monster roaming the countryside. Run, he's fuzzy, get out of here.


iheartscotch: fusillade762: Bunk! Bunk, I say! Bring me a bag full of Bigfoot's droppings or shut up!

I think we've had this conversation before.

If that's the evidence required; then, how do I know that you exsist?

Give me your address, I'll mail you some poop.


I'll assume that there will be a photo of a large, blurry, furry thing accompanying said package.
 
2013-10-01 08:47:23 PM
Sasquatch is real. I've seen him being pranked with beef jerky.
 
2013-10-01 08:48:37 PM
 
2013-10-01 08:48:39 PM
FTF"Peer-reviewed journal":  To purchase the DNA  paper please go to Journal. Drop down to special issues. Then go thru paypal.  Then if you will please go to the contact page and send us your receipt number. We  will personally send you the paper immediately by email.
 
2013-10-01 08:49:30 PM
You want DNA proof of Sasquatch?
Well here it is: ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGC CTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGG AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCC CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAG TTTAATTACAGACCTGAA

/could not be more obvious
 
2013-10-01 08:51:38 PM

FatherChaos: Are you sure they didn't find a Jewpacabra?


Nah.   Sasquatch is Jewish.

www.adherents.com
 
2013-10-01 08:53:38 PM
"$500K on blob-squatch and I'm still just a meme."

www.streetviewfun.com
 
2013-10-01 08:54:26 PM

xanadian: I'd like to read TFA, but it's all blurry and pixelated.


Japanese porn?
 
2013-10-01 08:56:56 PM
13,000 years ago there was a mass extinction event that killed off most of the megafauna (except grizzlies and bisons) and nearly wiped out the first humans to colonize the North American continent, the Clovis Indians. Over hundreds of generations due to genetic population bottlenecks, the descendants of Clovis Indians became tall and hairy. When the second wave of humans arrived, there was tribal warfare and the Bigfoot who might've built those giant serpentine mounds in Ohio and elsewhere were slaughtered and scattered by the newcomers. The arrival of Europeans might've been what saved Bigfoot from final extinction (for example, the local Paiute tribe celebrates the genocide of redheaded ogres from the north). It should be noted that Bigfoot pass for human because they still are human. A few decades ago, a Press-Telegram reporter and photographer interviewed and took pictures of a Bigfoot who had ventured south into Burbank, California because he was snow birding like other seniors, taking advantage of the flood canals and soup kitchens. I predict that one day through DNA matching that the closest relatives to Bigfoot will be those red haired steppe riders whose mummies have been discovered in China.
 
2013-10-01 08:57:19 PM

Oldiron_79: devildog123: They claim to have DNA "proof."  OK, show it then, don't act all mysterious.  If your goal is to be taken seriously, lead with your strongest evidence, not some grainy home movies of someone in a crappy Chewbacca costume.  Please, show me, I'll wait.

This.


She did.  Started sending her research out to other dna labs about a year ago.  None of them will touch the situation with a 10 foot pole.  I've heard her on the radio and, for what it's worth, she really seems to believe what she's saying and sounds sufficiently sane.
 
2013-10-01 08:58:50 PM
Short and grainy, just like Apollo 11 moon landing.
 
2013-10-01 09:00:43 PM
I don't believe it's real, but it would be funny as hell if it did turn out to be real... imagine the epic butthurt. I think the prospect is just sweet.
 
Al!
2013-10-01 09:01:28 PM

megarian: Dow Jones and the Temple of Doom: And you can order the DVD "proof" for just $29.95

AND you can get your teeth whitened, your aura massaged, AND your depression cured by 44.4938%!!!


Almost 45%???  SOLD!!

/My aura needed a massage, anyway
 
2013-10-01 09:01:47 PM
I thought John Marston killed the last one.
 
2013-10-01 09:05:55 PM

drjekel_mrhyde: devildog123: They claim to have DNA "proof."  OK, show it then, don't act all mysterious.  If your goal is to be taken seriously, lead with your strongest evidence, not some grainy home movies of someone in a crappy Chewbacca costume.  Please, show me, I'll wait.

I'm calling BS also, someone in the south would've shoot that damn thing.


Yeah, it's Kentucky. We just had our first wolf sighting in decades, and the first person who saw it shot it dead.
 
2013-10-01 09:06:30 PM

Ed Grubermann: And what, pray tell, did the bigfoot evolve from? We are the only ape species to ever colonize the New World. Until you can show me a lineage you're just blowing smoke up my ass.


First off no I do not believe in Bigfoot, so don't take this as an argument for its existence. But there was a very large ape that lived in east Asia. Gigantopithecus could have crossed on the same land bridge Native Americans used. They've never found pelvic or leg bones so it'd be understandable if their bones haven't been found here yet even if they did come over.

Again I'm not arguing for Bigfoot. It's just that your argument against it isn't very strong.
 
2013-10-01 09:16:34 PM
Farking hell - they got teen bigfoot on video; old mamma bigfoot and a lazy-ass bigfoot sleeping on the ground!

No wonder most bigfoot footage is blurry. If they weren't they'll look as retarded as the ones in the article.

Bigfoot doesn't exist, you assholes. It's Americana mythmaking at its best.

Now that Mothman...he gives me the creeps. A friend of an uncle's dentist said he once saw a man say he witnessed the Mothman fly straight in a streetlight that looked like a UFO.
 
2013-10-01 09:17:01 PM

fusillade762: Bunk! Bunk, I say! Bring me a bag full of Bigfoot's droppings or shut up!


I have the droppings of someone who *saw* Bigfoot.
 
2013-10-01 09:17:12 PM
Consultant?
www.littleblackstar.com
 
2013-10-01 09:17:12 PM
jaytkay


TFA: "This was a serious study," Ketchum said...

Cut it out, I'm super serial.....
 
2013-10-01 09:19:32 PM

skantea: Oldiron_79: devildog123: They claim to have DNA "proof."  OK, show it then, don't act all mysterious.  If your goal is to be taken seriously, lead with your strongest evidence, not some grainy home movies of someone in a crappy Chewbacca costume.  Please, show me, I'll wait.

This.

She did.  Started sending her research out to other dna labs about a year ago.  None of them will touch the situation with a 10 foot pole.  I've heard her on the radio and, for what it's worth, she really seems to believe what she's saying and sounds sufficiently sane.


The same can be said of the door-to-door "Do you have a moment to talk about Jesus?" folks.
 
Displayed 50 of 137 comments

First | « | 1 | 2 | 3 | » | Last | Show all

View Voting Results: Smartest and Funniest


This thread is closed to new comments.

Continue Farking
Submit a Link »






Report