If you can read this, either the style sheet didn't load or you have an older browser that doesn't support style sheets. Try clearing your browser cache and refreshing the page.

(The New York Times)   Supreme Court to decide if one day you could be sued by a patent troll who argues your DNA infringes on their client's gene patents   (nytimes.com) divider line 108
    More: Interesting, Look at a Gene Issue, DNA, supreme courts, gene patents, friend of the courts, Myriad Genetics, genes  
•       •       •

3616 clicks; posted to Geek » on 03 Dec 2012 at 7:11 PM   |  Favorite    |   share:  Share on Twitter share via Email Share on Facebook   more»



108 Comments   (+0 »)
   
View Voting Results: Smartest and Funniest

Archived thread

First | « | 1 | 2 | 3 | » | Last | Show all
 
2012-12-03 08:20:54 PM
Kinek: Magorn: Theaetetus: pheelix: Small time farmers get their ass sued off when they use seed produced by their own crops which thanks to the wind and honeybees were pollinated by the genetically modified crop in the field across the street the genetically modified crop which they've carefully collected and isolated by destroying all of the non-modified crop it was mixed with.

FTFY. There are some reasonable questions around the Monsanto suit, but its disingenuous to claim that bees and the wind were responsible for the field of 100% Monsanto canola.

No, but then the discovery that plants can spontaneously "swap" genes through the air raises a question as to whether that actually WAS Monsanto Canola or just had some of the smae genetic markers

The Max Planck Institute. Now that brings back memories.

Reading carefully though, that's CHLOROPLAST swap. Not genomic. It's a little different. What you might be looking for is the recent publications on horizontal gene transfer due to third parties in plants. Which occur more often than we originally guessed. Again though, probably not in this case. You'd have to pick up an awfully specific part of the genome to get what happened to have happened. As much as I hate to admit it, Thaetus is right. There are a lot of dirty hands in the Monsanto cases, and not all of them are corporate.


Now this is purely hypothetical, but this is how we lawyers think. Suppose the USC rules in favor of the patent. Further suppose that someone "patents" genetic variations for increased strength, intelligence, more resistance to disease, etc (IIRC there's a genetic variation found in rural England that gives natural immunity to some nasty plagues), and further suppose you could create "designer" babies by buying these genes from the patent holder and injecting them into a fetus' genome shortly after conception.

Now that kid grows up, is interested in having kids of his own. Based on those Monsanto case precedents, would it be reasonable/legal to require the child to obtain a license from the patent holder, or at least pay them royalties for each kid they have?
 
2012-12-03 08:22:15 PM
Theaetetus: Arguably, they could have. Mind you, only isolated quarks would infringe their patent, so it's not as if they could run out and slap everyone with suits.

If I remove a living human brain and put it on life support, can I patent it?
 
2012-12-03 08:22:53 PM
Theaetetus: Kinek: Theaetetus: Cubicle Jockey: Theaetetus: Sure, isolating is straightforward... Finding out which ones to isolate, there's the difficult part. It's like the old joke about the doctor's bill with $5 for hitting you with a hammer, and $295 for knowing where to hit.

So in your opinion, if people didn't know what caused sugar cane sap to be sweet, someone could have patented glucose?

No, see the other post. Glucose does exist on its own in nature, and therefore is not a "new" composition of matter.

A tree is not patentable, but apparently its leaf is.

Leaves fall off trees and lie on the ground on their own. I think the monopole is a better comparison. :P

The claim that the new isolated DNA is new is idiotic. The purpose of the copy is so that it can be read and the original sequence inferred. If it was 'NEW' then PCR would be farking worthless.

Claiming that something can't be new because it's used for something that isn't new is illogical. Computers do calculations that have existed for thousands of years, so they can't be new either?

Kinek: Which is why the CAFC judge bent over backwards to claim that the 'synthetic' molecule's production was patentable when it has no right to be. Not the fact that the Allele A results in Breast cancer. They started out at 'This is patentable. I just need to figure out how.'

I know what you mean, but that's the process they're supposed to follow - specifically "this is presumed patentable. Can I prove that it's not?" It's similar to the requirements of "innocent until proven guilty". In this case, they asked if they could prove that it was not a new composition of matter but already existent in nature, and, within the narrow bounds of the claim, they couldn't.


I don't think the monopole is a better example. A Monopole is fundamentally different than a magnet. An isolated chunk of Gene is not fundamentally different than when it is present in DNA. We're going to ignore histones and methylation since they're not important to the conversation. The end product here is not the synthetic product itself, but the information contained in it. The synthetic product is only useful in that it can be read. But they can't patent the information since it falls under a host of cases, and the fact that you can't patent a fact. I don't think. And if they were patenting the information, that /would/ put them square in the path of the Prometheus ruling.

My issue is this. Myriad was told 'You cannot patent DNA', and 'You cannot patent facts'. So instead, the judge let them patent the intermediate step in order to get from DNA to Facts. A process they have nothing to do with. They don't own the PCR patent. You've just let someone take A->B->C. Of which A and C cannot be patented, the first arrow's patent is expired, the second arrow's patent is not theirs, and said that B is patentable.
 
2012-12-03 08:33:40 PM
Magorn: Kinek: Magorn: Theaetetus: pheelix: Small time farmers get their ass sued off when they use seed produced by their own crops which thanks to the wind and honeybees were pollinated by the genetically modified crop in the field across the street the genetically modified crop which they've carefully collected and isolated by destroying all of the non-modified crop it was mixed with.

FTFY. There are some reasonable questions around the Monsanto suit, but its disingenuous to claim that bees and the wind were responsible for the field of 100% Monsanto canola.

No, but then the discovery that plants can spontaneously "swap" genes through the air raises a question as to whether that actually WAS Monsanto Canola or just had some of the smae genetic markers

The Max Planck Institute. Now that brings back memories.

Reading carefully though, that's CHLOROPLAST swap. Not genomic. It's a little different. What you might be looking for is the recent publications on horizontal gene transfer due to third parties in plants. Which occur more often than we originally guessed. Again though, probably not in this case. You'd have to pick up an awfully specific part of the genome to get what happened to have happened. As much as I hate to admit it, Thaetus is right. There are a lot of dirty hands in the Monsanto cases, and not all of them are corporate.

Now this is purely hypothetical, but this is how we lawyers think. Suppose the USC rules in favor of the patent. Further suppose that someone "patents" genetic variations for increased strength, intelligence, more resistance to disease, etc (IIRC there's a genetic variation found in rural England that gives natural immunity to some nasty plagues), and further suppose you could create "designer" babies by buying these genes from the patent holder and injecting them into a fetus' genome shortly after conception.

Now that kid grows up, is interested in having kids of his own. Based on those Monsanto case precedents, would it be reas ...


Now, I'm not a lawyer, but I don't think that people are treated the same as plants. That would be one of the reasons I'm in crop science and not human genetics. Apparently ethics boards get grumpy when you start selectively breeding people. Or burning them. Or dissecting them. Lot less paperwork, and all I have to deal with is Anti-GM people instead of PETA. Or the Hague.

Human rights aside, this wouldn't work to fleece the company selling genes. THis ties into one of the reasons that farmers have to buy elite hybrid seed every year. Due to the way many genes work in these elite hybrids, homozygotes (Containing two of the same Alleles) are often at a disadvantage, compared to heterozygotes (A and B). The heterozygosity is what makes them especially fit. But their offspring will be 25% AA, 50% AB, and 25% BB. The next generation will only be half Elite. Same could probably be true of whatever modifications there might be.

The issue here is not the patentability of DNA (The Human Genome Project Race saw a bill that made that specifically not possible), but the patentability of isolated segments. These isolated segments are at the moment necessary to a functional 'read' of what the genome possesses.
 
2012-12-03 08:38:23 PM
Kinek: The issue here is not the patentability of DNA (The Human Genome Project Race saw a bill that made that specifically not possible), but the patentability of isolated segments.

If you can patent a segment, you can patent the whole genome piecemeal.
 
2012-12-03 08:41:53 PM
doyner: Kinek: The issue here is not the patentability of DNA (The Human Genome Project Race saw a bill that made that specifically not possible), but the patentability of isolated segments.

If you can patent a segment, you can patent the whole genome piecemeal.


Functionally, you can keep people from reading it, as this current case stands. So you can't patent the DNA itself, but you can sure as hell keep people from accessing it. Which is why the CAFC ruling irritated me.
 
2012-12-03 08:48:06 PM
Kinek: doyner: Kinek: The issue here is not the patentability of DNA (The Human Genome Project Race saw a bill that made that specifically not possible), but the patentability of isolated segments.

If you can patent a segment, you can patent the whole genome piecemeal.

Functionally, you can keep people from reading it, as this current case stands. So you can't patent the DNA itself, but you can sure as hell keep people from accessing it. Which is why the CAFC ruling irritated me.


Pisses me off too. I'm worried about the corporitist makeup of SCOTUS these days and how this is not a slam dunk.
 
2012-12-03 08:52:00 PM
Meh, patents were designed to protect the creative and inventive who create something unique or innovative.

Pocketable shapes are a matter of course(ie the Apple suits), not created and unique. Same goes for basic science, imo.

Patent trolling in this modern era is just disgusting.

You should not be able to patent discovery, in this sense, because it's not a creative or unique process, and other scientists in the same field will come upon it as a matter of course, eventually, and sooner rather than later when working with what we have here.

The process IS a product of nature. you add chemical X, and you will see Z yeild Y reaction, every time. Laws of chemistry and physics.

If you want to make money off of a discovery, secrecy is your friend. That is the only thing that really protects such things as recipes and methodology when it comes to cooking or making drinks. Some other mixologist/chef who stumbles on the right recipe on his own is immune to any suit(ideally....our civil court system is broken, but that is the spirit of the law).
 
2012-12-03 08:54:25 PM
doyner: Kinek: doyner: Kinek: The issue here is not the patentability of DNA (The Human Genome Project Race saw a bill that made that specifically not possible), but the patentability of isolated segments.

If you can patent a segment, you can patent the whole genome piecemeal.

Functionally, you can keep people from reading it, as this current case stands. So you can't patent the DNA itself, but you can sure as hell keep people from accessing it. Which is why the CAFC ruling irritated me.

Pisses me off too. I'm worried about the corporitist makeup of SCOTUS these days and how this is not a slam dunk.


Should amuse you to note that the DoJ wrote an Amicus brief suggesting that the patent not be valid. Also, with the AMA and a few other health organizations protesting this, hopefully they'll rule sanely. The CAFC is a patent friendly court, don't take their opinion as indicative of the supreme courts. Myriad has a weak as fark case. As I've pointed out above, if the plaintiffs do -any- research at all, then Myriad should be torn to shreds. The CAFC tried to do an end run around everything here and say that some intermediate process was patentable. Hopefully that's seen as what it is.
 
2012-12-03 08:57:04 PM
omeganuepsilon: Meh, patents were designed to protect the creative and inventive who create something unique or innovative.

Pocketable shapes are a matter of course(ie the Apple suits), not created and unique. Same goes for basic science, imo.

Patent trolling in this modern era is just disgusting.

You should not be able to patent discovery, in this sense, because it's not a creative or unique process, and other scientists in the same field will come upon it as a matter of course, eventually, and sooner rather than later when working with what we have here.

The process IS a product of nature. you add chemical X, and you will see Z yeild Y reaction, every time. Laws of chemistry and physics.

If you want to make money off of a discovery, secrecy is your friend. That is the only thing that really protects such things as recipes and methodology when it comes to cooking or making drinks. Some other mixologist/chef who stumbles on the right recipe on his own is immune to any suit(ideally....our civil court system is broken, but that is the spirit of the law).


I understand what you're getting at, but of all the things in the world to advocate secrecy in, Genomics is not one of them. And consortiums and data-sharing is the lifeblood of these massive projects.
 
2012-12-03 09:05:09 PM
I think this is probably the one subject where I become a drooling neanderthal.

No. No no no no no. FFS keep your dirty, money-grubbing, capitalistic hands off my DNA! Seriously! Is there one place that is not sacred from these shiatbags who are a waste of good oxygen?

For some reason, people start talking cloning and corporations and being sued for the mere temerity to breed and I just lose it. Normally, I'm a relatively rational mostly-liberal, but on this one I might as well be a fundie Muslim. I don't mind patenting drugs, I don't mind patenting treatments and tests and what have you. . . but holy crap the right to patent a FARKING DNA SEQUENCE? You might as well hand a baby a set of building blocks and sequence random bits of DNA just on the off chance that ONE will be some multi-billion dollar cure to some disease.

This is the kind of stuff that does make me wish we'd blow ourselves up already. We'd do less damage long term, and the rest of the world would get the chance to move on without us.
 
2012-12-03 09:08:46 PM
Peki: I think this is probably the one subject where I become a drooling neanderthal.

No. No no no no no. FFS keep your dirty, money-grubbing, capitalistic hands off my DNA! Seriously! Is there one place that is not sacred from these shiatbags who are a waste of good oxygen?

For some reason, people start talking cloning and corporations and being sued for the mere temerity to breed and I just lose it. Normally, I'm a relatively rational mostly-liberal, but on this one I might as well be a fundie Muslim. I don't mind patenting drugs, I don't mind patenting treatments and tests and what have you. . . but holy crap the right to patent a FARKING DNA SEQUENCE? You might as well hand a baby a set of building blocks and sequence random bits of DNA just on the off chance that ONE will be some multi-billion dollar cure to some disease.

This is the kind of stuff that does make me wish we'd blow ourselves up already. We'd do less damage long term, and the rest of the world would get the chance to move on without us.


They're not patenting the Sequence!

They're just patenting the ability to read this particular section of sequence by making the intermediate patentable. Which is even worse in some ways.
 
2012-12-03 09:14:44 PM
Kinek: I understand what you're getting at, but of all the things in the world to advocate secrecy in, Genomics is not one of them. And consortiums and data-sharing is the lifeblood of these massive projects.

Not advocating it at all, just talking about the situation in general. If you're part of a larger body of work as such, you sort of give up the right to make exclusive monies. Absolutely, everyone working on raw science in that environment, that could benefit humanity, should share, that's precisely what you signed up for.

That is the ideal scientist, take the prestige, and earn grants and employments based on your abilities and image.

Copping out and being secretive with such things and trying to make signifigantly more money for zero further work, is just plain being a bastard.

Puts me in mind of crooked organizations like the RIAA, who want to profit indefinitely for very finite work.
 
2012-12-03 09:17:30 PM
omeganuepsilon: Kinek: I understand what you're getting at, but of all the things in the world to advocate secrecy in, Genomics is not one of them. And consortiums and data-sharing is the lifeblood of these massive projects.

Not advocating it at all, just talking about the situation in general. If you're part of a larger body of work as such, you sort of give up the right to make exclusive monies. Absolutely, everyone working on raw science in that environment, that could benefit humanity, should share, that's precisely what you signed up for.

That is the ideal scientist, take the prestige, and earn grants and employments based on your abilities and image.

Copping out and being secretive with such things and trying to make signifigantly more money for zero further work, is just plain being a bastard.

Puts me in mind of crooked organizations like the RIAA, who want to profit indefinitely for very finite work.


I'm in it to get something named after me. Fark y'all.

I'm kidding. But one of the requirements for participation in some of these consortiums is that under no circumstances can you patent what you come up with the groups data. I'm sure there's plenty of story behind that. And I'm betting one of them involves Myriad.
 
2012-12-03 09:46:34 PM
Michael Crichton wrote a book about this called "Next". Basically about a biotech that forcibly tried to take a biopsy from a person because they owned the patent on their genes. Or something like that. The book was stupid, in part due to the ridiculous plot. Sadly it doesn't seem quite so ridiculous now.
 
2012-12-03 09:50:40 PM
Someone should apply for the patent for all genes and give their name as God.
 
2012-12-03 09:52:08 PM
Isn't the better question at this point 'what the hell is wrong with the US Patent Office?'

If they didn't issue these asinine patents in the first place, wouldn't that significantly cut down on the subsequent lawsuits?
 
2012-12-03 09:59:24 PM
cman: Ok, I am confused by this (GASP AINT THAT A SHOCKER!)

I looked at the WP entry on the lawsuit and still am having some issues processing it.

Are they claiming that the test to find a certain gene is their patent? Or, are they claiming the gene is the patent itself? I cannot make heads or tales of this damn thing


The patent is on the "isolated genetic sequence." You can't patent most natural products, so you technically can't patent the genetic sequence itself, since it exists in nature. But what they ended up being able to patent, when some judges and patent lawyers without a clue let them do it decades ago, is patent the PCR (polymerase chain reaction) amplified product, which is really just a controlled reaction that makes a copy of a specific genetic sequence. That product can then be sequenced (read), which is the test.

It's still bullshiat, and I'm fundamentally opposed, as a human genetics researcher, to patenting of gene sequences unless it is truly synthetic in origin. But there is a lot of hyperbole in how many people interpret these patents and their effects. They have bad consequences, don't get me wrong, but not nearly as bad as the headline implies or some of the comments in the thread.
 
2012-12-03 10:00:23 PM
SacriliciousBeerSwiller: Michael Crichton wrote a book about this called "Next". Basically about a biotech that forcibly tried to take a biopsy from a person because they owned the patent on their genes. Or something like that. The book was stupid, in part due to the ridiculous plot. Sadly it doesn't seem quite so ridiculous now.

Its still ridiculous. For all that is wrong with gene patents, that isn't how they work. Micheal Crichton became an anti-scientific luddite at some point in his career, was pretty sad to see.
 
2012-12-03 10:04:44 PM
Kinek: doyner: Kinek: doyner: Kinek: The issue here is not the patentability of DNA (The Human Genome Project Race saw a bill that made that specifically not possible), but the patentability of isolated segments.

If you can patent a segment, you can patent the whole genome piecemeal.

Functionally, you can keep people from reading it, as this current case stands. So you can't patent the DNA itself, but you can sure as hell keep people from accessing it. Which is why the CAFC ruling irritated me.

Pisses me off too. I'm worried about the corporitist makeup of SCOTUS these days and how this is not a slam dunk.

Should amuse you to note that the DoJ wrote an Amicus brief suggesting that the patent not be valid. Also, with the AMA and a few other health organizations protesting this, hopefully they'll rule sanely. The CAFC is a patent friendly court, don't take their opinion as indicative of the supreme courts. Myriad has a weak as fark case. As I've pointed out above, if the plaintiffs do -any- research at all, then Myriad should be torn to shreds. The CAFC tried to do an end run around everything here and say that some intermediate process was patentable. Hopefully that's seen as what it is.


Given the ruling earlier this year by SCOTUS with regards to Mayo Collaborative Services versus Prometheus Laboratories, they aren't so corporatist that they can't see common sense on these subjects. Now from what I recall they specifically worded the ruling so it wouldn't be considered precedent for this case, but it still speaks to how they are likely to view certain aspects of it.

I believe we decided in Canada all ready that these sorts of gene patents weren't valid so Myriad's patent is already void here (IIRC)
 
2012-12-03 10:07:49 PM
KWess: Isn't the better question at this point 'what the hell is wrong with the US Patent Office?'

If they didn't issue these asinine patents in the first place, wouldn't that significantly cut down on the subsequent lawsuits?


Meh, the workers there work within the legal guidelines they're handed. It's just a job.

The government and law(to include precedent, often conflicting and pants on head retarded verdicts) are part of the real issue here. A large part of both has been influenced by money in the past, as well as manipulation of largely ignorant "peer" juries.

When the RIAA calls in a "favor" to the government, and then our government calls in a request to get the guys from Pirate Bay arrested in switzerland or wherever they were, the system as a whole is largely farked. Only once the money got big enough did the government stand up and take action like that. They certainly didn't care in decades past. People making mix tapes from the radio? "Get over it" was the official response when such things started to surface.

Sure, patents, copyrights, and trademarks are all technically different, but the principles are all the same, and it's gotten out of hand.
 
2012-12-03 10:08:32 PM
This sounds like a really elaborate way of getting out of paying child support.
 
2012-12-03 10:15:54 PM
entropic_existence: Kinek: doyner: Kinek: doyner: Kinek: The issue here is not the patentability of DNA (The Human Genome Project Race saw a bill that made that specifically not possible), but the patentability of isolated segments.

If you can patent a segment, you can patent the whole genome piecemeal.

Functionally, you can keep people from reading it, as this current case stands. So you can't patent the DNA itself, but you can sure as hell keep people from accessing it. Which is why the CAFC ruling irritated me.

Pisses me off too. I'm worried about the corporitist makeup of SCOTUS these days and how this is not a slam dunk.

Should amuse you to note that the DoJ wrote an Amicus brief suggesting that the patent not be valid. Also, with the AMA and a few other health organizations protesting this, hopefully they'll rule sanely. The CAFC is a patent friendly court, don't take their opinion as indicative of the supreme courts. Myriad has a weak as fark case. As I've pointed out above, if the plaintiffs do -any- research at all, then Myriad should be torn to shreds. The CAFC tried to do an end run around everything here and say that some intermediate process was patentable. Hopefully that's seen as what it is.

Given the ruling earlier this year by SCOTUS with regards to Mayo Collaborative Services versus Prometheus Laboratories, they aren't so corporatist that they can't see common sense on these subjects. Now from what I recall they specifically worded the ruling so it wouldn't be considered precedent for this case, but it still speaks to how they are likely to view certain aspects of it.

I believe we decided in Canada all ready that these sorts of gene patents weren't valid so Myriad's patent is already void here (IIRC)


I already mentioned Prometheus. But yeah, that's what gives me hope. That's why this case is heading to the Supreme court, because of the request for re-examination in light of the Prometheus decision. In function, both of them are the same. Companies patenting facts and associations. Myriad just happened to have a 'synthetic' intermediate which adds a bulwark against efforts to invalidate it.
 
2012-12-03 10:19:39 PM
entropic_existence: SacriliciousBeerSwiller: Michael Crichton wrote a book about this called "Next". Basically about a biotech that forcibly tried to take a biopsy from a person because they owned the patent on their genes. Or something like that. The book was stupid, in part due to the ridiculous plot. Sadly it doesn't seem quite so ridiculous now.

Its still ridiculous. For all that is wrong with gene patents, that isn't how they work. Micheal Crichton became an anti-scientific luddite at some point in his career, was pretty sad to see.


I swear to Fark Jesus if I ever introduce myself as a geneticist of any sort, within five minutes, Jurassic park gets brought up. He was an anti-science luddite early on. Or to be more specific, 'Science doesn't have all the answers. Lalalalalala.'
 
2012-12-03 11:13:21 PM
Kinek: Do you want your photocopier changing your document around? Perhaps editing some words?

That would be awesome for PPT presentations.
 
2012-12-03 11:15:51 PM
saturn badger: Kinek: Do you want your photocopier changing your document around? Perhaps editing some words?

That would be awesome for PPT presentations.


Now you've got me in the mood to wander down to the Software engineering section of campus and asking someone to take a copy of powerpoint and massage it into randomly inverting every couple of words every time you open the presentation.
 
2012-12-03 11:22:23 PM
I'm trying really hard to understand what Myriad has done..Here is an explanation and the two sides of the court case as set forth by Businessweek: Link

"The isolated DNA molecules before us are not found in nature," Circuit Judge Alan Lourie wrote. "They are obtained in the laboratory and are man-made, the product of human ingenuity. While they are prepared from products of nature, so is every other composition of matter."

Genes are encoded strands of nucleotides in different sequences that are responsible for inherited traits. In isolating genes, Myriad strips out unneeded information to home in on aspects that determine whether a person has a higher risk of breast and ovarian cancer.

The challengers say isolated DNA is identical to the coding that exists naturally in the body.

"Isolation simply makes a person's genetic information more accessible for sequencing by medical professionals," the group argued.

___________________________________________________________________

It seems that Myriad takes genetic material from patients, processes it, and claims a patent on the resulting "isolated" material. The isolated material is not altered; it's the same stuff that came from the patient. It's simply revealed, stripped of other material that made it difficult to examine.

If that's so, how in Hell can that judge call it "man-made?"

Did BW get it wrong? Am I misinterpreting something?
 
2012-12-03 11:33:03 PM
BarkingUnicorn: I'm trying really hard to understand what Myriad has done..Here is an explanation and the two sides of the court case as set forth by Businessweek: Link

"The isolated DNA molecules before us are not found in nature," Circuit Judge Alan Lourie wrote. "They are obtained in the laboratory and are man-made, the product of human ingenuity. While they are prepared from products of nature, so is every other composition of matter."

Genes are encoded strands of nucleotides in different sequences that are responsible for inherited traits. In isolating genes, Myriad strips out unneeded information to home in on aspects that determine whether a person has a higher risk of breast and ovarian cancer.

The challengers say isolated DNA is identical to the coding that exists naturally in the body.

"Isolation simply makes a person's genetic information more accessible for sequencing by medical professionals," the group argued.

___________________________________________________________________

It seems that Myriad takes genetic material from patients, processes it, and claims a patent on the resulting "isolated" material. The isolated material is not altered; it's the same stuff that came from the patient. It's simply revealed, stripped of other material that made it difficult to examine.

If that's so, how in Hell can that judge call it "man-made?"

Did BW get it wrong? Am I misinterpreting something?


No. That's all correct. That's why it's insane. PCR product (upon which this entire patent hangs at the moment) is for all intents and purposes functionally identical to the copy found in the genome. Minus some histones and methylation cues, but that's not important. Using a process that they don't hold the patent for (PCR), they take something that cannot be patented (Genomic DNA), make a copy of the thing that is identical to the genomic DNA (That they can't patent), then read it (Using tech that they don't have the patent for), and come up with a series of ATCGs (Information that they can't patent due to the fact that this is a fact in nature).

//PCR product is a section of Polymerase made DNA that is made over and over and over so we can read it. Like taking a page from a book, photocopying it 100000 times so you can read it from a very tall building. It's hard to read one lone page. Many copies are easier to read.
 
2012-12-03 11:37:26 PM
Kinek: BarkingUnicorn: I'm trying really hard to understand what Myriad has done..Here is an explanation and the two sides of the court case as set forth by Businessweek: Link

"The isolated DNA molecules before us are not found in nature," Circuit Judge Alan Lourie wrote. "They are obtained in the laboratory and are man-made, the product of human ingenuity. While they are prepared from products of nature, so is every other composition of matter."

Genes are encoded strands of nucleotides in different sequences that are responsible for inherited traits. In isolating genes, Myriad strips out unneeded information to home in on aspects that determine whether a person has a higher risk of breast and ovarian cancer.

The challengers say isolated DNA is identical to the coding that exists naturally in the body.

"Isolation simply makes a person's genetic information more accessible for sequencing by medical professionals," the group argued.

___________________________________________________________________

It seems that Myriad takes genetic material from patients, processes it, and claims a patent on the resulting "isolated" material. The isolated material is not altered; it's the same stuff that came from the patient. It's simply revealed, stripped of other material that made it difficult to examine.

If that's so, how in Hell can that judge call it "man-made?"

Did BW get it wrong? Am I misinterpreting something?

No. That's all correct. That's why it's insane. PCR product (upon which this entire patent hangs at the moment) is for all intents and purposes functionally identical to the copy found in the genome. Minus some histones and methylation cues, but that's not important. Using a process that they don't hold the patent for (PCR), they take something that cannot be patented (Genomic DNA), make a copy of the thing that is identical to the genomic DNA (That they can't patent), then read it (Using tech that they don't have the patent for), and come up with a series of A ...


It's not so much processing, or stripping out, as highlighting a section of the genome, hitting ctrl c, and then pressing a brick down on ctrl v. That's it. It's not magical. It's not some complicated process. It's a really, really, really farking simple concept.

www.ucl.ac.uk
 
2012-12-03 11:44:30 PM
Dear fine and upstanding individuals of this thread whom are both knowledgeable and reticent about this case.

This is the same Chief Justice that managed to make both sides angry and, at the same time, accept that UHC was something that is both a tax and a service.

I assure you he's going to adjourn the Supreme Court behind closed doors, they'll all discuss what is the best method to handle this across all fronts... and then tell them to go DIAF.
 
2012-12-04 12:02:47 AM
Kinek: entropic_existence: SacriliciousBeerSwiller: Michael Crichton wrote a book about this called "Next". Basically about a biotech that forcibly tried to take a biopsy from a person because they owned the patent on their genes. Or something like that. The book was stupid, in part due to the ridiculous plot. Sadly it doesn't seem quite so ridiculous now.

Its still ridiculous. For all that is wrong with gene patents, that isn't how they work. Micheal Crichton became an anti-scientific luddite at some point in his career, was pretty sad to see.

I swear to Fark Jesus if I ever introduce myself as a geneticist of any sort, within five minutes, Jurassic park gets brought up. He was an anti-science luddite early on. Or to be more specific, 'Science doesn't have all the answers. Lalalalalala.'


Wasn't the moral of Jurassic Park that genetics is awesome, and that the idea of cloning dinosaurs is so unbelievably awesome that any potential downsides can and should be ignored because DINOSAURS, FARK YEAH!

I read it when I was ten and that was my takeaway.
 
2012-12-04 12:17:58 AM
So the patented product IS man-made and not the original material taken from the patient. But each copy of the original material in the product is identical to the original material.

Myriad doesn't own patents on the processes used to create such products. But it claims a patent on a product that contains copies of this particular gene sequence.

This is like saying, "Hey, I painted a copy of the Mona Lisa using MY OWN PAINT, so nobody can paint another without paying me!"

Throw the bums out.
 
2012-12-04 01:44:46 AM
Snarfangel: What do you mean, Monsanto says I can't have sex? And why am I classified as "Roundup Ready?"

Pretty much this.
 
2012-12-04 02:03:54 AM
lennavan: BarkingUnicorn: Myriad Genetics is arguing that the molecules it has patented do not occur in nature. How would that entitle them to ownership of the naturally occurring condition and other methods of detecting and treating it?

Ask them. Also - these do occur in nature. That's kinda the entire point. That these things occur in breast cancer patients, which is why they wanted to include in the patent any ways to detect them.

BarkingUnicorn: If this patent applies to a method of creating man-made molecules that can be used to detect and/or treat naturally occurring genetic defects

I'm not sure how to best explain this without needing some biology background. Let me try it this way. DNA is made up of A, T, C and G. So for a very specific region of the genome, called BRCA1, these guys figured this out:

GAAGTTATCAGTCGACGTGAGCTCGCTGAGACTTCCTGGACGGGGGACAGGCTGTGGGGT
TTCTCAGATAACTGGGCCCCTGCGCTCAGGAGGCCTTCACCCTCTGCTCTGGGTAAAGTT
CATTGGAACAGAAAGAAATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCA
TTAATGCTATGCAGAAAATCTTAGAGTGTCCCATCTGTCTGGAGTTGATCAAGGAACCTG
TCTCCACAAAGTGTGACCACATATTTTGCAAATTTTGCATGCTGAAACTTCTCAACCAGA
AGAAAGGGCCTTCACAGTGTCCTTTATGTAAGAATGATATAACCAAAAGGAGCCTACAAG
AAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTGTGCTTTTCAGC
TTGACACAGGTTTGGAGTATGCAAACAGCTATAATTTTGCAAAAAAGGAAAATAACTCTC
CTGAACATCTAAAAGATGAAGTTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCA
AAAGACTTCTACAGAGTGAACCCGAAAATCCTTCCTTGCAGGAAACCAGTCTCAGTGTCC
AACTCTCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGCAGCGGATACAACCTCAAA
AGACGTCTGTCTACATTGAATTGGGATCTGATTCTTCTGAAGATACCGTTAATAAGGCAA
CTTATTGCAGTGTGGGAGATCAAGAATTGTTACAAATCACCCCTCAAGGAACCAGGGATG
AAATCAGTTTGGATTCTGCAAAAAAGGCTGCTTGTGAATTTTCTGAGACGGATGTAACAA
ATACTGAACATCATCAACCCAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTG
AGAGGCATCCAGAAAAGTATCAGGGTAGTTCTGTTTCAAACTTGCATGTGGAGCCATGTG
GCACAAATACTCATGCCAGCTCATTACAGCATGAGAACAGCAGTTTATTACTCACTAAAG
ACAGAATGAATGTAGAAAAGGCTGAATTCTGTAATAAAAGCAAACAGCCTGGCTTAGCAA
GGAGCCAACATAACAGATGGGCTGGAAGTAAGGAAACATGTAATGATAGGCGGACTCCCA
GCACAGAAAAAAAGGTAGATC ...


To further illustrate: I can do this sequencing in several days (counting shipping time) with a cheek swab from any female within any reasonable distance, and get the same result (minus tandem repeats, SNPs, etc). It is literally the easiest thing to do in molecular biology, and these asshats put a patent on it.
 
2012-12-04 02:27:47 AM
static data cannot be patented and as it was created by your parents, its Copyright "them" anyway.

Till that 20 year margin wears out. Funny how that kinda works out in US law already.

Given that its ALL "prior work" and they cannot show any kind of "innovation" the whole concept is damned stupid.
 
2012-12-04 06:54:06 AM
I'm going to file a patent for a set of molecules I've isolated in human urine, then charge a royalty whenever anyone anywhere takes a piss.
 
2012-12-04 06:59:51 AM
So, what if the estates of Watson and Crick suddenly decided they wanted royalties for anyone who used their discovery of the structure of DNA in their research or testing? Would this guy be happy to pony up?

The only reason humanity escaped the Dark Ages is because we developed methods to record our knowledge so that future generations could start from what we'd already learned rather than having to learn it all over from scratch on their own, thus allowing the development of systems that require several lifetimes' worth of knowledge to create. If we start privately hoarding our current knowledge in the name of "Waaah, I want credit!", it is going to be a giant roadblock to any future innovation.
 
2012-12-04 07:20:40 AM
Fast Moon: So, what if the estates of Watson and Crick suddenly decided they wanted royalties for anyone who used their discovery of the structure of DNA in their research or testing? Would this guy be happy to pony up?

The only reason humanity escaped the Dark Ages is because we developed methods to record our knowledge so that future generations could start from what we'd already learned rather than having to learn it all over from scratch on their own, thus allowing the development of systems that require several lifetimes' worth of knowledge to create. If we start privately hoarding our current knowledge in the name of "Waaah, I want credit!", it is going to be a giant roadblock to any future innovation.


You do know that patent applications detail the invention that the inventor is seeking protection on? And that all published applications and issued patents are publicly available for anyone to read? And that one of the entire purposes of the patent system is to get inventors to disclose their inventions and discoveries, and in exchange give them a time limited exclusive right?

And in your example, what Watson and Crick discovered (the double helix structure) was something they observed that was already already found in nature, and would therefore be ineligible subject matter by the holding in Prometheus, much less prior decisions like Gottshalk . And there are limits to when you can file an application, you can't disclose your invention or discovery and then have your estates file an application 60 years later. If you seriously think that's possible, you need to actually read some of the patent law.
 
2012-12-04 07:56:11 AM
eXyRael: I'm going to file a patent for a set of molecules I've isolated in human urine, then charge a royalty whenever anyone anywhere takes a piss.

Talk about trickle down theory..
 
2012-12-04 08:00:23 AM
BarkingUnicorn: So the patented product IS man-made and not the original material taken from the patient. But each copy of the original material in the product is identical to the original material.

Myriad doesn't own patents on the processes used to create such products. But it claims a patent on a product that contains copies of this particular gene sequence.

This is like saying, "Hey, I painted a copy of the Mona Lisa using MY OWN PAINT, so nobody can paint another without paying me!"

Throw the bums out.


It's not even their own paint.

It's like taking photoshop, taking a painting that's not yours, blowing the painting up so you can look at a portion of the painting, and then saying that the blown up portion is now patentable. Literally nothing in this case is actually theirs or patentable. From the code to the PCR process to the read technology to the data. None of it is Myriad's or patentable. The only thing they 'innovated' on was the association between this gene and Breast cancer. Which to re-emphasize, IS NOT PATENTABLE. The judge clutched at straws to keep the patent valid by finding SOMETHING that might be patentable. Essentially the buffer for your youtube video.
 
2012-12-04 08:02:04 AM
mcjon01: Kinek: entropic_existence: SacriliciousBeerSwiller: Michael Crichton wrote a book about this called "Next". Basically about a biotech that forcibly tried to take a biopsy from a person because they owned the patent on their genes. Or something like that. The book was stupid, in part due to the ridiculous plot. Sadly it doesn't seem quite so ridiculous now.

Its still ridiculous. For all that is wrong with gene patents, that isn't how they work. Micheal Crichton became an anti-scientific luddite at some point in his career, was pretty sad to see.

I swear to Fark Jesus if I ever introduce myself as a geneticist of any sort, within five minutes, Jurassic park gets brought up. He was an anti-science luddite early on. Or to be more specific, 'Science doesn't have all the answers. Lalalalalala.'

Wasn't the moral of Jurassic Park that genetics is awesome, and that the idea of cloning dinosaurs is so unbelievably awesome that any potential downsides can and should be ignored because DINOSAURS, FARK YEAH!

I read it when I was ten and that was my takeaway.


I should have never read it as a conscious adult. That was my takeaway as a ten year old too.
 
2012-12-04 08:36:30 AM
The thing that nobody seems to mention is that patenting naturally occurring genes is just like patenting cancer. The genes and cancer already exist, everybody has the right to study them, it's the cure that gets patented, not the problem. It's ridiculous that this problem has been allowed to get so far out of hand.
 
2012-12-04 09:06:17 AM
Kinek: I already mentioned Prometheus. But yeah, that's what gives me hope. That's why this case is heading to the Supreme court, because of the request for re-examination in light of the Prometheus decision. In function, both of them are the same. Companies patenting facts and associations. Myriad just happened to have a 'synthetic' intermediate which adds a bulwark against efforts to invalidate it.

Yeah, I only checked the beginning and end of the thread, so I missed you bringing it up. At least I can generally count on some other solid fellow science farkers to jump in to these threads :)

Kinek: I swear to Fark Jesus if I ever introduce myself as a geneticist of any sort, within five minutes, Jurassic park gets brought up. He was an anti-science luddite early on. Or to be more specific, 'Science doesn't have all the answers. Lalalalalala.'

With a streak of "Science will kill us all with its immoral behaviour" as well.

Kinek: No. That's all correct. That's why it's insane. PCR product (upon which this entire patent hangs at the moment) is for all intents and purposes functionally identical to the copy found in the genome. Minus some histones and methylation cues, but that's not important. Using a process that they don't hold the patent for (PCR), they take something that cannot be patented (Genomic DNA), make a copy of the thing that is identical to the genomic DNA (That they can't patent), then read it (Using tech that they don't have the patent for), and come up with a series of ATCGs (Information that they can't patent due to the fact that this is a fact in nature).

//PCR product is a section of Polymerase made DNA that is made over and over and over so we can read it. Like taking a page from a book, photocopying it 100000 times so you can read it from a very tall building. It's hard to read one lone page. Many copies are easier to read.


Best summary ever.

Kinek: It's not so much processing, or stripping out, as highlighting a section of the genome, hitting ctrl c, and then pressing a brick down on ctrl v. That's it. It's not magical. It's not some complicated process. It's a really, really, really farking simple concept.

And not to mention that the process itself is just a controlled and simplified version of how DNA is copied during cell division in the first place.

Kinek: I should have never read it as a conscious adult. That was my takeaway as a ten year old too.

Its why I haven't re-read it since I was a teenager, or read anything by Chrichton since I finished my undergrad.
 
2012-12-04 10:27:34 AM
entropic_existence: And not to mention that the process itself is just a controlled and simplified version of how DNA is copied during cell division in the first place.

That's the part that galls me about the whole pronouncement by the company and the judge that this is man-made. It's not. At least less so than most of things. Dog shiat is not manmade. Insulin is not man-made (by which I mean commercially synthesized quantities delivered to us by GM E. Coli). We borrowed Taq from a bacteria in yellowstone, we take DNA from somewhere else, and all we really do is hijack a natural process for our own ends. The only thing you did, Myriad, when you run this test, is mix everything together. That's it. And of course, found the association. But we've already decided that you can't exclude the market from that information.
 
2012-12-04 10:30:52 AM
entropic_existence: Kinek: I already mentioned Prometheus. But yeah, that's what gives me hope. That's why this case is heading to the Supreme court, because of the request for re-examination in light of the Prometheus decision. In function, both of them are the same. Companies patenting facts and associations. Myriad just happened to have a 'synthetic' intermediate which adds a bulwark against efforts to invalidate it.

Yeah, I only checked the beginning and end of the thread, so I missed you bringing it up. At least I can generally count on some other solid fellow science farkers to jump in to these threads :)

Kinek: I swear to Fark Jesus if I ever introduce myself as a geneticist of any sort, within five minutes, Jurassic park gets brought up. He was an anti-science luddite early on. Or to be more specific, 'Science doesn't have all the answers. Lalalalalala.'

With a streak of "Science will kill us all with its immoral behaviour" as well.

Kinek: No. That's all correct. That's why it's insane. PCR product (upon which this entire patent hangs at the moment) is for all intents and purposes functionally identical to the copy found in the genome. Minus some histones and methylation cues, but that's not important. Using a process that they don't hold the patent for (PCR), they take something that cannot be patented (Genomic DNA), make a copy of the thing that is identical to the genomic DNA (That they can't patent), then read it (Using tech that they don't have the patent for), and come up with a series of ATCGs (Information that they can't patent due to the fact that this is a fact in nature).

//PCR product is a section of Polymerase made DNA that is made over and over and over so we can read it. Like taking a page from a book, photocopying it 100000 times so you can read it from a very tall building. It's hard to read one lone page. Many copies are easier to read.

Best summary ever.

Kinek: It's not so much processing, or stripping out, as highlighting a section of the genome, hitt ...


One last note. Dinosaurs>Morality. When was the last time Kant gave me velociraptors? Or Apatasauruses? I'll still take feathered archeaopteryx over the is-ought problem.
 
2012-12-04 10:43:51 AM
Kinek: One last note. Dinosaurs>Morality. When was the last time Kant gave me velociraptors? Or Apatasauruses? I'll still take feathered archeaopteryx over the is-ought problem.

I would love a real life Jurassic Park myself. Totally bad ass. Also, other than it basically being impossible to really clone dinosaurs (we can maybe reverse engineer them and make Pseudo-Dinosaurs) it isn't a bad idea. Crichton had to make a thriller of course but the notion that it would be inherently more dangerous than running a zoo or game preserve was downright stupid.
 
2012-12-04 10:46:20 AM
entropic_existence: Kinek: One last note. Dinosaurs>Morality. When was the last time Kant gave me velociraptors? Or Apatasauruses? I'll still take feathered archeaopteryx over the is-ought problem.

I would love a real life Jurassic Park myself. Totally bad ass. Also, other than it basically being impossible to really clone dinosaurs (we can maybe reverse engineer them and make Pseudo-Dinosaurs) it isn't a bad idea. Crichton had to make a thriller of course but the notion that it would be inherently more dangerous than running a zoo or game preserve was downright stupid.


I would argue things like Pterosaurs could be very problematic. Large, winged predatory reptiles would cause some issues.
 
2012-12-04 10:53:14 AM
nekulor: I would argue things like Pterosaurs could be very problematic. Large, winged predatory reptiles would cause some issues.

Sure, if you build your park like a moron. It was more the idea from Crichton that such failures were inevitable that was stupid. Not that it would be dead simple to build an adequate park.
 
2012-12-04 11:00:26 AM
entropic_existence: nekulor: I would argue things like Pterosaurs could be very problematic. Large, winged predatory reptiles would cause some issues.

Sure, if you build your park like a moron. It was more the idea from Crichton that such failures were inevitable that was stupid. Not that it would be dead simple to build an adequate park.


Well, we do have the occasional slip-up at a Zoo, but nothing like the animals breeding, killing their caregivers and building a thriving new island ecosystem based on a flawed genetic premise that incorporation of frog DNA would allow them to evolve the ability to be hermaphroditic faster. Also, if they used that genome, but didn't account for that possibility, then that entire team of geneticists should have been beaten to death. That's a rookie mistake in genetic engineering and construction of chimeric organisms. Step one is always know your base genome, and what the organism is capable of.
 
2012-12-04 11:17:05 AM
nekulor: Well, we do have the occasional slip-up at a Zoo, but nothing like the animals breeding, killing their caregivers and building a thriving new island ecosystem based on a flawed genetic premise that incorporation of frog DNA would allow them to evolve the ability to be hermaphroditic faster. Also, if they used that genome, but didn't account for that possibility, then that entire team of geneticists should have been beaten to death. That's a rookie mistake in genetic engineering and construction of chimeric organisms. Step one is always know your base genome, and what the organism is capable of.

Not to mention that of course, it would entirely depend on what genes they used. Plus using amphibian genes was idiotic in the first place, birds would be better for a subset of dinosaurs, other reptiles being best for others. All kinds of wrong with the genetics of that book.
 
Displayed 50 of 108 comments

First | « | 1 | 2 | 3 | » | Last | Show all

View Voting Results: Smartest and Funniest


This thread is closed to new comments.

Continue Farking
Submit a Link »





Report