If you can read this, either the style sheet didn't load or you have an older browser that doesn't support style sheets. Try clearing your browser cache and refreshing the page.

(CBC)   Residents unhappy with city's decision to paint over crosswalk decide to paint their own   (cbc.ca) divider line 81
    More: Spiffy, crosswalks, Halifax Regional Municipality  
•       •       •

16964 clicks; posted to Main » on 02 Nov 2012 at 9:34 PM   |  Favorite    |   share:  Share on Twitter share via Email Share on Facebook   more»



81 Comments   (+0 »)
   
View Voting Results: Smartest and Funniest

Archived thread

First | « | 1 | 2 | » | Last | Show all
 
2012-11-02 08:24:34 PM
FTFA: Local homeowners called the city but couldn't convince anyone to reinstate the crossings, so recently some of them lost their patience.

[...]

Homeowners aren't the only ones who disagree with the traffic officials, at least two Dartmouth councillors say crosswalks people have used for years should not be taken away.


Sounds like it's aboot time to fire some traffic officials.
 
2012-11-02 08:36:51 PM
abbeyroad.jpg
 
ZAZ [TotalFark]
2012-11-02 08:42:02 PM
Take the names of the painters. If there is an accident in their crosswalk they are liable.
 
2012-11-02 09:14:03 PM
This sounds like the premise for an epic video game - "Crosswalk Painter". Objective: paint your own crosswalk while avoiding getting hit
 
2012-11-02 09:14:34 PM
ZAZ: Take the names of the painters. If there is an accident in their crosswalk they are liable.

This is Canada up here, we may look the same but we aren't.
 
2012-11-02 09:27:01 PM
This would make for an interesting defense to a failure-to-stop-at-a-crosswalk citation.
 
2012-11-02 09:35:38 PM
Whose sidewalk?

"Ours."
 
2012-11-02 09:36:56 PM
Indubitably: Whose sidewalk?

"Ours."


"You work for me, sir."

"Let's do this together, okay?"

"Thank you."
 
ZAZ [TotalFark]
2012-11-02 09:37:02 PM
This would make for an interesting defense to a failure-to-stop-at-a-crosswalk citation.

Where I live you should beat the ticket but the verdict in the civil suit is up to the jury if you hit somebody.
 
2012-11-02 09:40:06 PM
If the photo shows the location of where the crosswalk was, then no shiat it should have been removed. It's right in the middle of a multi-lane road, and doesn't even connect to a ramp.

Just because "it was there for 20 yearsx doesn't mean it was safe or well thought out.
 
2012-11-02 09:41:46 PM
Follow up article: vandals arrested today for painting their own crosswalks on a public road.
 
2012-11-02 09:42:48 PM
Step 1: Move to Canada
Step 2: Install homemade toll booth
Step 3: Profit
 
2012-11-02 09:43:47 PM
media.glassdoor.com
Never bring a keg of beer to a crosswalk painting party.
 
2012-11-02 09:44:05 PM
Love and Canada.

Mutual.
 
2012-11-02 09:44:29 PM
Indubitably: Indubitably: Whose sidewalk?

"Ours."

"You work for me, sir."

"Let's do this together, okay?"

"Thank you."


Do you have entire conversations with yourself? If so; I postulate that it may be a sign of insanity on your part.

/ did the voices tell you to paint the crosswalk?

// I keed, I keed
 
ZAZ [TotalFark]
2012-11-02 09:44:40 PM
doesn't even connect to a ramp

I missed that. In the United States you can't add a new crosswalk without ramps and cities are supposed to have plans to add ramps at existing locations. My city has no fear of traffic engineering standards but does resist installing crosswalks without curb cuts. ADA lawyers are scarier than ambulance chasers.
 
2012-11-02 09:45:15 PM
It's an extra-wide luxury sidewalk.
 
2012-11-02 09:48:43 PM
The exact opposite happened in a backwater Rhode Island town a few years back: a crosswalk was painted where nobody wanted one. Linky-pop
 
2012-11-02 09:51:35 PM
iheartscotch: Indubitably: Indubitably: Whose sidewalk?

"Ours."

"You work for me, sir."

"Let's do this together, okay?"

"Thank you."

Do you have entire conversations with yourself? If so; I postulate that it may be a sign of insanity on your part.

/ did the voices tell you to paint the crosswalk?

// I keed, I keed


Have you ever written anything like a story in space? With gravity? It's dense, no?

Conversations with my self?

That's either a great name for a band or a book, no?

*)
 
2012-11-02 09:51:44 PM
some of the neighbours have decided on their own to put them back," he said.

Just how many people do you think it takes to spray-paint two lines?
 
2012-11-02 09:56:36 PM
smitty04: [media.glassdoor.com image 500x375]
Never bring a keg of beer to a CHRISTIAN crosswalk painting party.
 
2012-11-02 09:56:46 PM
Dow Jones and the Temple of Doom: If the photo shows the location of where the crosswalk was, then no shiat it should have been removed. It's right in the middle of a multi-lane road, and doesn't even connect to a ramp.

Just because "it was there for 20 yearsx doesn't mean it was safe or well thought out.


Curb cuts are fairly new additions in most places (I can remember not too long ago where they were the exception and not the rule) and can be expensive to put in (over $1,000 a pop (or more) multiplied by however many crosswalks you have adds up pretty quickly). If they had been mandated at the Canadian equivalent of the USDOT level like they have been here then it certainly cheaper to simply get rid of the crosswalks instead of putting in the curb cut.

What is your definition of a multi-lane road" One lane in each direction? That's pretty much every road out there. That looks like a two lane road and a parking spot to me (the "T" in the center of the cross walk gives it away). Even if it's not a two lane road, just around the corner from me is a 50' wide 3 lane (one turning lane) street with a crosswalk (with curb cuts) and no stop sign or other signage for it, not even a Ped Xing marking on the street leading up to it. It is a 3-way, not a 4 way, intersection.

The crosswalks are there for the residents and if they want them and voice that need loudly and city hall won't provide them then it's the fault of city hall if someone gets killed jaywalking. Or they could put the unauthorized markings back where they used to be and let drivers know where to expect to see people crossing the street.
 
2012-11-02 09:57:23 PM
Dow Jones and the Temple of Doom: If the photo shows the location of where the crosswalk was, then no shiat it should have been removed. It's right in the middle of a multi-lane road, and doesn't even connect to a ramp.

Just because "it was there for 20 yearsx doesn't mean it was safe or well thought out.


it isn't in the same spot. google maps shows what used to be..

i47.photobucket.com
 
2012-11-02 09:58:04 PM
It's more legitimate because the citizens put it there. If you strike a pedestrian, the government won't do anything but the people may drag you out of your car and judge you. This is a better system.
 
2012-11-02 09:58:56 PM
American Decency Association: Dow Jones and the Temple of Doom: If the photo shows the location of where the crosswalk was, then no shiat it should have been removed. It's right in the middle of a multi-lane road, and doesn't even connect to a ramp.

Just because "it was there for 20 yearsx doesn't mean it was safe or well thought out.

it isn't in the same spot. google maps shows what used to be..

[i47.photobucket.com image 850x483]


oops, wrong angle. it is the same spot
 
2012-11-02 09:58:58 PM
iheartscotch: Indubitably: Indubitably: Whose sidewalk?

"Ours."

"You work for me, sir."

"Let's do this together, okay?"

"Thank you."

Do you have entire conversations with yourself? If so; I postulate that it may be a sign of insanity on your part.

/ did the voices tell you to paint the crosswalk?

// I keed, I keed


P.S. In person, I doubt you would portray this character to me. And if you did, wtf is wrong with you? Grow up. Diagnose yourself, look in a mirror, and then promptly VObama, you fascist bastard.

P.P.S. Mr. President, I fully suspect that when you are reelected, you will scale back the violations of American privacy under the Patriot Act. And, perhaps, somehow get Citizens United repealed, somehow. If you cannot, democracy is intransigent and obfuscated forever. I got your back. *Shield*
 
2012-11-02 09:59:15 PM
images4.wikia.nocookie.net

As long as the intersection is properly marked with a sop, yeld, or a one vay sign

/Not obscure in the slightest
 
2012-11-02 10:00:31 PM
A few students at my high school did something similar. The city refused to put a crosswalk in front of the school and the cops would constantly sit in front before/after school and give out jaywalking tickets. One night, a couple students took a can of spray paint and made their own crosswalk across the street.

The city and school administrators didn't find the humor; however, they did eventually paint a crosswalk directly in front of the high school.
 
2012-11-02 10:06:26 PM
Well, it's Canada so they were probably in a rush. But I think the final result was a real triumph. Anyone who gets hit by a car is going to end up like goreguts on a skinny puppy covered in 3 inches of blood and found in the bush D.O.A. And the driver will be known as an annihilator for the rest of his life if they can get his body out of the car with a crowbar.
 
2012-11-02 10:09:44 PM
Dow Jones and the Temple of Doom: If the photo shows the location of where the crosswalk was, then no shiat it should have been removed. It's right in the middle of a multi-lane road, and doesn't even connect to a ramp.

Just because "it was there for 20 yearsx doesn't mean it was safe or well thought out.


Forget the ramp. It doesn't even connect to a sidewalk. It connects to a lawn. WTF.
 
2012-11-02 10:10:08 PM
If that is regular latex paint it might last a week. Maybe.
 
2012-11-02 10:10:31 PM
Jozabad: The exact opposite happened in a backwater Rhode Island town a few years back: a crosswalk was painted where nobody wanted one. Linky-pop

FTFA:

Distances between points are actual distances, without regard to lakes or listless bridesmaids.

Listless bridesmaids? I could use a few of those.
 
2012-11-02 10:12:25 PM
Being that it's Dartmouth, it surprises me not at all that no one knew how to use a chalk line.

Also, the best joke I've ever heard about Dartmouth (and there are many, believe me) was this: "Dartmouth has one thing that Halifax will never, ever have: a great view of Halifax."

/Haligonian

Regarding the party tomorrow night, I must sadly predict that the Halifax Fark party will be a dismal failure. NS residents aren't all stupid (even though this may be the most inbred province in Canada, Newfoundland notwithstanding), and the translation 'New Scotland' does have some merit regarding how cheap people can be, but I don't know a whole lot of people willing to piss away $6 for a beer (tip included) without a peeler being involved. I will celebrate at home in sympathy, though. :-)
 
2012-11-02 10:15:26 PM
Ryker's Peninsula: Well, it's Canada so they were probably in a rush. But I think the final result was a real triumph. Anyone who gets hit by a car is going to end up like goreguts on a skinny puppy covered in 3 inches of blood and found in the bush D.O.A. And the driver will be known as an annihilator for the rest of his life if they can get his body out of the car with a crowbar.

Did I miss any?
 
2012-11-02 10:21:34 PM
TheGreatGazoo: If that is regular latex paint it might last a week. Maybe.

Still, the point has been made, and they'll probably get something official back. Or they'll keep repainting it.
 
2012-11-02 10:21:40 PM
A Terrible Human

Ryker's Peninsula: Well, it's Canada so they were probably in a rush. But I think the final result was a real triumph. Anyone who gets hit by a car is going to end up like goreguts on a skinny puppy covered in 3 inches of blood and found in the bush D.O.A. And the driver will be known as an annihilator for the rest of his life if they can get his body out of the car with a crowbar.

Did I miss any? 

Just Triumph I think...
 
2012-11-02 10:26:08 PM
Indubitably: iheartscotch: Indubitably: Indubitably: Whose sidewalk?

"Ours."

"You work for me, sir."

"Let's do this together, okay?"

"Thank you."

Do you have entire conversations with yourself? If so; I postulate that it may be a sign of insanity on your part.

/ did the voices tell you to paint the crosswalk?

// I keed, I keed

Have you ever written anything like a story in space? With gravity? It's dense, no?

Conversations with my self?

That's either a great name for a band or a book, no?

*)



I ❤ you, Indub.

You're the only Farker I have Favorited in plaid.

:-)
 
2012-11-02 10:28:49 PM
in my little USA town there is a side access road to a viaduct that is no longer accessible from the main road because the person operating the road striping machine painted where there shouldn't be paint.

out on the two lane highway through town people would make an illegal turn over the double line in front of oncoming traffic to go food shopping. so the town spent a bundle putting in a red light with a turn so you could safely go in to the shopping area. and all the idiots who have been making an illegal turn over the double yellow lines for the last 30 years still do it as if the red light doesn't exist.
 
2012-11-02 10:29:00 PM
smitty04: [media.glassdoor.com image 500x375]
Never bring a keg of beer to a crosswalk painting party.


That is crying out for a "Möbius Crossing" sign.
 
2012-11-02 10:30:32 PM
Ryker's Peninsula: Well, it's Canada so they were probably in a rush. But I think the final result was a real triumph. Anyone who gets hit by a car is going to end up like goreguts on a skinny puppy covered in 3 inches of blood and found in the bush D.O.A. And the driver will be known as an annihilator for the rest of his life if they can get his body out of the car with a crowbar.

Niiice, very nice.
 
2012-11-02 10:30:39 PM
I don't know how it is up north, but it's darn near impossible to walk anywhere around here. Keeps us Americans fat and lazy. Just jump in the car to cross the street, too dangerous to walk.
 
2012-11-02 10:31:15 PM
dammit, this is why we need a SPLIFFY tag.
 
2012-11-02 10:31:29 PM
Transportation planner here. Marked crosswalks are kind of like an "attractive nuisance". You are inviting irresponsible behavior. Pedestrians get mowed down in them all the time. It gives you a false sense of security.

Softy mushy flesh is no match for hard metal at high velocity.
 
2012-11-02 10:32:19 PM
smitty04: [media.glassdoor.com image 500x375]
Never bring a keg of beer to a crosswalk painting party.


You beer keg, I see DNA sequence.
 
2012-11-02 10:33:13 PM
Amos Quito: Indubitably: iheartscotch: Indubitably: Indubitably: Whose sidewalk?

"Ours."

"You work for me, sir."

"Let's do this together, okay?"

"Thank you."

Do you have entire conversations with yourself? If so; I postulate that it may be a sign of insanity on your part.

/ did the voices tell you to paint the crosswalk?

// I keed, I keed

Have you ever written anything like a story in space? With gravity? It's dense, no?

Conversations with my self?

That's either a great name for a band or a book, no?

*)


I ❤ you, Indub.

You're the only Farker I have Favorited in plaid.

:-)


Thank you, friend.

I feel death-vibes from the fray tonight, albeit.

Good news: *Shaman-Shield*

P.S. Fuk off, I have writing to do, you fuks. *)
 
2012-11-02 10:35:28 PM
A Terrible Human: Ryker's Peninsula: Well, it's Canada so they were probably in a rush. But I think the final result was a real triumph. Anyone who gets hit by a car is going to end up like goreguts on a skinny puppy covered in 3 inches of blood and found in the bush D.O.A. And the driver will be known as an annihilator for the rest of his life if they can get his body out of the car with a crowbar.

Did I miss any?


Triumph? Skinny Puppy, 3 Inches of Blood, Goreguts (sic), Annihilator, .... chime in if I missed some.
 
2012-11-02 10:46:46 PM
KrispyKritter: in my little USA town there is a side access road to a viaduct that is no longer accessible from the main road because the person operating the road striping machine painted where there shouldn't be paint.

out on the two lane highway through town people would make an illegal turn over the double line in front of oncoming traffic to go food shopping. so the town spent a bundle putting in a red light with a turn so you could safely go in to the shopping area. and all the idiots who have been making an illegal turn over the double yellow lines for the last 30 years still do it as if the red light doesn't exist.


Where does double yellow lines mean no left turn?
 
2012-11-02 10:48:07 PM
Benjimin_Dover: KrispyKritter: in my little USA town there is a side access road to a viaduct that is no longer accessible from the main road because the person operating the road striping machine painted where there shouldn't be paint.

out on the two lane highway through town people would make an illegal turn over the double line in front of oncoming traffic to go food shopping. so the town spent a bundle putting in a red light with a turn so you could safely go in to the shopping area. and all the idiots who have been making an illegal turn over the double yellow lines for the last 30 years still do it as if the red light doesn't exist.

Where does double yellow lines mean no left turn?


"...the White Zone is for unloading and loading only..."
 
2012-11-02 10:50:33 PM
Fark Me To Tears: Sounds like it's aboot time to fire some traffic officials.

onoffon.info
 
2012-11-02 10:51:46 PM
Indubitably:
You just want me to have an abortion!

smitty04:
[GACTTCGATGTACGTGAGTTCAAAC]
Never bring a keg of beer bored, drunk molecular biologists to a crosswalk painting party.
 
Displayed 50 of 81 comments

First | « | 1 | 2 | » | Last | Show all

View Voting Results: Smartest and Funniest


This thread is closed to new comments.

Continue Farking
Submit a Link »





Report