If you can read this, either the style sheet didn't load or you have an older browser that doesn't support style sheets. Try clearing your browser cache and refreshing the page.
Fark SearchWeb Fark

         more options... Create account

(Washington Post) Cool Scientists have learned some amaizing kernels of truth from mapping the corn genome. "They're just popping up"   (washingtonpost.com) divider line 63
More: Cool  
•       •       •

4727 clicks; posted to Main » on 20 Nov 2009 at 10:47 AM   |  Make this a Fark FavoriteFavorite    |   share: Share on OMGTWITTER WEB2.0share on StumbleUponshare on Facebook  more»   |    Get this fabulous T-Shirt and impress the methane out of your friends! shirt it!

63 Comments   (+0 »)


First | « | 1 | 2 | » | Last | Show all
 
make me some tea [TotalFark] 2009-11-20 08:02:05 AM  
Corn is superior to any other food.

 
RabidDog [TotalFark] 2009-11-20 08:03:29 AM  
make me some tea: Corn is superior to any other food.

It's all going to kick off again isn't it.

 
Sir Cumference the Flatulent [TotalFark] 2009-11-20 08:03:52 AM  
I HAS A CORM

 
Sir Cumference the Flatulent [TotalFark] 2009-11-20 08:04:29 AM  
RabidDog: It's all going to kick off again isn't it.

It's better than a f*cking Pokemon thread.

 
ZAZ [TotalFark] 2009-11-20 08:08:27 AM  
Corn has been modified by man. Is it really that good an example?

Domestic rice differs from wild in one gene, the one that makes rice grains fall off or stick. Corn is much more different from proto-corn (maize) than that.

 
Sun God [TotalFark] 2009-11-20 08:09:23 AM  
Corn would be extinct without human involvement.

 
shivashakti [TotalFark] 2009-11-20 08:44:06 AM  
It's remarkable how everything we eat has some sort of corn product in it today. And by "remarkable", I mean, "frightening".

 
Sir Cumference the Flatulent [TotalFark] 2009-11-20 09:14:24 AM  
make me some tea: Corn is superior to any other food.

Even bacon?

 
Pocket Ninja [TotalFark] 2009-11-20 09:17:53 AM  
Sir Cumference the Flatulent: Even bacon?

Pigs eat corn and convert the corn into bacon.

 
witchofthedogs [TotalFark] 2009-11-20 09:22:05 AM  
Oh, this means war.

 
ne2d [TotalFark] 2009-11-20 09:24:45 AM  
make me some tea: Corn is superior to any other food.

You're right--what other food can make it through the human digestive tract virtually unscathed?

 
RabidDog [TotalFark] 2009-11-20 09:27:02 AM  
ne2d: You're right--what other food can make it through the human digestive tract virtually unscathed?

This, in a nutshell, is my argument.

 
FelineMommy27 [TotalFark] 2009-11-20 09:38:44 AM  
Pocket Ninja: Sir Cumference the Flatulent: Even bacon?

Pigs eat corn and convert the corn into bacon.


This frightens me.

RabidDog: ne2d: You're right--what other food can make it through the human digestive tract virtually unscathed?

This, in a nutshell, is my argument.


Actually, that argument's in the toilet.

 
Sir Cumference the Flatulent [TotalFark] 2009-11-20 09:45:53 AM  
ne2d: You're right--what other food can make it through the human digestive tract virtually unscathed?

Fiberglas.

} said I was hardcore

 
FelineMommy27 [TotalFark] 2009-11-20 09:47:29 AM  
Sir Cumference the Flatulent: ne2d: You're right--what other food can make it through the human digestive tract virtually unscathed?

Fiberglas.

} said I was hardcore


O_o

 
make me some tea [TotalFark] 2009-11-20 09:48:19 AM  
Sir Cumference the Flatulent: make me some tea: Corn is superior to any other food.

Even bacon?


Now there's a conundrum.

 
St_Francis_P [TotalFark] 2009-11-20 10:00:50 AM  
shivashakti: It's remarkable how everything we eat has some sort of corn product in it today. And by "remarkable", I mean, "frightening".

That's because everybody likes corn. Not using it would go against the grain.

 
Sir Cumference the Flatulent [TotalFark] 2009-11-20 10:07:57 AM  
make me some tea: Now there's a conundrum.

Granted it's not a ballsack conundrum, but a conundrum nonetheless.

} conundrum

 
abb3w [TotalFark] 2009-11-20 10:27:55 AM  
So, no evolution-thread-with-popcorn this morning?

 
Angry Drunk Bureaucrat [TotalFark] 2009-11-20 10:31:39 AM  
You have a good earn for corn puns, Submitter.

 
Angry Drunk Bureaucrat [TotalFark] 2009-11-20 10:33:31 AM  
Angry Drunk Bureaucrat: You have a good earn for corn puns, Submitter.

Damn. Should have seen that, but my potatoes are the ones with the eyes.

I can already hear the beanstalk about my blunder.

 
St_Francis_P [TotalFark] 2009-11-20 10:43:59 AM  
Angry Drunk Bureaucrat: Angry Drunk Bureaucrat: You have a good earn for corn puns, Submitter.

Damn. Should have seen that, but my potatoes are the ones with the eyes.

I can already hear the beanstalk about my blunder.


I'll lend you a sympathetic ear.

 
FelineMommy27 [TotalFark] 2009-11-20 10:50:39 AM  
This is already getting really corny.

 
StaleCoffee 2009-11-20 10:50:48 AM  
ne2d: make me some tea: Corn is superior to any other food.

You're right--what other food can make it through the human digestive tract virtually unscathed?


Pennies

 
Not An Alt 2009-11-20 10:53:13 AM  
The thing that bothers me about modern corn is the fact that most of the corn grown today is inedible until it's processed. What kind of shiat is that?

Also, corn feed is an unnatural diet for cows and pigs, and will eventually kill them, if we weren't slaughtering them before the adverse effects started kicking in.

Also, I wonder if they had to get licensing rights to study the corn genome. Hasn't monsanto patented a lot of the genome already?

 
Kazan 2009-11-20 10:56:30 AM  
Not An Alt: The thing that bothers me about modern corn is the fact that most of the corn grown today is inedible until it's processed. What kind of shiat is that?


because "field corn" is hardier than sweet corn and easier to harvest mechanically.

it should be used primarily for animal feed, not farking HFCS

HFCS is a plague

 
bawlmer 2009-11-20 10:56:59 AM  
ne2d: make me some tea: Corn is superior to any other food.

You're right--what other food can make it through the human digestive tract virtually unscathed?


www.eraser0815.gmxhome.de

 
sprd 2009-11-20 10:57:41 AM  
What did the gene say to the other gene?

CTGAGAGGGAATTTAATAATTAAATTAGATACACCACCGAGAAT!!!!

hahhahahahahaha!

 
dryknife 2009-11-20 10:58:31 AM  
media.onsugar.com

Corn Smut (SFW?)

 
Not An Alt 2009-11-20 10:58:59 AM  
Kazan: because "field corn" is hardier than sweet corn and easier to harvest mechanically.

it should be used primarily for animal feed, not farking HFCS

HFCS is a plague


Yeah, they breed it down to be all starch, no protein. Also, monsanto has the liberty linked™ corn seed that allows you to spray your field and kill all vegetation except for the corn itself. This means they can get much higher yeilds per acre, that's why HFCS has replaced sugar in EVERYTHING.

 
CygnusDarius [TotalFark] 2009-11-20 11:05:01 AM  
make me some tea: Sir Cumference the Flatulent: make me some tea: Corn is superior to any other food.

Even bacon?

Now there's a conundrum.


Grilled corn wrapped in bacon.

www.foodtv.ca

 
The_Fuzz 2009-11-20 11:06:59 AM  
Not An Alt: This means they can get much higher yeilds per acre, that's why HFCS has replaced sugar in EVERYTHING.

Also because they lobby the hell out of your government to make importing sugar expensive and inconvenient. I'm happy that most food in Canada still is made with sugar, though HFCS creeps into some products.


Corn should only be used for Corn Bread, Corn Chips, Pop Corn, Corn Tortillas, uhmm, and corn on the cob. Turning it into a sweetener is just wrong.

 
Isildur [TotalFark] 2009-11-20 11:08:45 AM  
Angry Drunk Bureaucrat: Angry Drunk Bureaucrat: You have a good earn for corn puns, Submitter.

Damn. Should have seen that, but my potatoes are the ones with the eyes.

I can already hear the beanstalk about my blunder.


"Soya heard about Angry Drunk Bureaucrat's typo?"
"No, goya head and tell me!"

 
fizzix_is_fun 2009-11-20 11:12:31 AM  
Not An Alt: Yeah, they breed it down to be all starch, no protein. Also, monsanto has the liberty linked™ corn seed that allows you to spray your field and kill all vegetation except for the corn itself. This means they can get much higher yeilds per acre, that's why HFCS has replaced sugar in EVERYTHING.

Sugar is not really much better for you than HFCS. They're both pretty bad.

 
CygnusDarius [TotalFark] 2009-11-20 11:12:56 AM  
To make good corn on the cob (taken from Three Panel Soul):

Soak the corn, husks still on, in a pot of water. If you can't submerge them completely, make sure the tassle side is down. Let them soak for 15 to 20 minutes.

While you're waiting, get the grill hot. You'll have to start sooner than this if you're using a charcoal grill, but if you're using a gas grill, just crank it to medium-high.

Once the corn is soaked, throw it on the grill, turning occasionally.

Keep them on, turning occasionally, for about half an hour. The husks will burn, but don't worry. The water will steam the corn inside the husk perfectly.

For best results, buy your corn from a man selling it along the side of the road from back of a pickup truck.

Aaand, the bacon-wrapped grilled corn on the cob recipe (new window).

 
Biv 2009-11-20 11:16:23 AM  
The_Fuzz: Not An Alt: This means they can get much higher yeilds per acre, that's why HFCS has replaced sugar in EVERYTHING.

Also because they lobby the hell out of your government to make importing sugar expensive and inconvenient. I'm happy that most food in Canada still is made with sugar, though HFCS creeps into some products.


Corn should only be used for Corn Bread, Corn Chips, Pop Corn, Corn Tortillas, uhmm, and corn on the cob. Turning it into a sweetener is just wrong.


"What some of them other corn products?"
"Uh...corn chowda'."
"Corn chowda."
"Corn on the cob."
"Corn on the cob. What's wrong witht he corn products we got?"

 
gr8fultom 2009-11-20 11:17:58 AM  
Note #3: I've also found that I like to pre-cook the bacon a little so that it's partially cooked, drizzled the small amount of fat mixed with a bit of oil or butter over the cobs, wrapped the bacon around, then gone on with the steps. Otherwise the bacon doesn't cook completely on the cob and is generally tossed away uneaten.

Nooooo!!!

 
Not An Alt 2009-11-20 11:20:41 AM  
fizzix_is_fun: Sugar is not really much better for you than HFCS. They're both pretty bad.

True, but try this experiment one day. Get a six pack of soda made with HFCS and a six pack of soda made w/ sugar instead. See which one you drink faster. For some reason, (now this is me personally and I don't have any scientific evidence to back it up)my body doesn't tell me I've had enough when it's HFCS. I could slam the whole six pack in an evening without realizing it. With the sugar, I drink it much slower, and don't feel like chugging the soda or having a second one. It's like my body tells me it's had enough sugar.

So, you're right that they're both bad, but for some reason, we metabolize corn syrup differently, which means we consume much more without having a signal from our bodies telling us to stop.

 
DownIncognito 2009-11-20 11:22:01 AM  
Soldiers of corn, lend me your ears!

 
CygnusDarius [TotalFark] 2009-11-20 11:23:22 AM  
gr8fultom: Note #3: I've also found that I like to pre-cook the bacon a little so that it's partially cooked, drizzled the small amount of fat mixed with a bit of oil or butter over the cobs, wrapped the bacon around, then gone on with the steps. Otherwise the bacon doesn't cook completely on the cob and is generally tossed away uneaten.

Nooooo!!!


My thoughts exactly. Who throws away a perfectly good piece of bacon?.

 
Head_Shot [TotalFark] 2009-11-20 11:26:53 AM  
CygnusDarius: To make good corn on the cob (taken from Three Panel Soul):
Soak the corn, husks still on, in a pot of water. If you can't submerge them completely, make sure the tassle side is down. Let them soak for 15 to 20 minutes.
While you're waiting, get the grill hot. You'll have to start sooner than this if you're using a charcoal grill, but if you're using a gas grill, just crank it to medium-high.
Once the corn is soaked, throw it on the grill, turning occasionally.
Keep them on, turning occasionally, for about half an hour. The husks will burn, but don't worry. The water will steam the corn inside the husk perfectly.
For best results, buy your corn from a man selling it along the side of the road from back of a pickup truck.
Aaand, the bacon-wrapped grilled corn on the cob recipe (new window).


Actually you want to completely submerge the corn "tassles up" to eliminate air pockets. We add salt and sugar to the water and let them soak for at least a couple hours.

Corn is sooo much tastier grilled than boiled or steamed.

 
Biv 2009-11-20 11:29:16 AM  
Damn you people. It is entirely too early in the day to be thinking about corn on the cob.

 
CygnusDarius [TotalFark] 2009-11-20 11:30:35 AM  
Head_Shot: Actually you want to completely submerge the corn "tassles up" to eliminate air pockets. We add salt and sugar to the water and let them soak for at least a couple hours.

Corn is sooo much tastier grilled than boiled or steamed.


Yes, add a little butter and a but of hot sauce (with no vinegar) and it's heaven.

farm4.static.flickr.com

 
fizzix_is_fun 2009-11-20 11:30:48 AM  
Not An Alt: fizzix_is_fun: Sugar is not really much better for you than HFCS. They're both pretty bad.

True, but try this experiment one day. Get a six pack of soda made with HFCS and a six pack of soda made w/ sugar instead. See which one you drink faster. For some reason, (now this is me personally and I don't have any scientific evidence to back it up)my body doesn't tell me I've had enough when it's HFCS. I could slam the whole six pack in an evening without realizing it. With the sugar, I drink it much slower, and don't feel like chugging the soda or having a second one. It's like my body tells me it's had enough sugar.

So, you're right that they're both bad, but for some reason, we metabolize corn syrup differently, which means we consume much more without having a signal from our bodies telling us to stop.


Sugar is mostly sucrose, half glucose and half fructose. HFCS is pretty much all fructose. Glucose is metabolized in the cells directly and will give the I'm full signal. Fructose can't be metabolized in the cells and goes directly to the liver where a large portion is converted to fat and it will actually inhibit the production of the "I'm full" signal since you are using energy to turn the fructose into fat. So it would make sense that you'd get fuller from sucrose than fructose.

From a health and fat production standpoint, they're about even. This is because fructose is significantly sweeter than sucrose so manufacturers use more sugar to get the same sweetness effect.

disclaimer: not a biochemist, you might want to fact-check this.

 
CygnusDarius [TotalFark] 2009-11-20 11:33:07 AM  
Biv: Damn you people. It is entirely too early in the day to be thinking about corn on the cob.

You know what that means? After work, go buy corn.

 
Kazan 2009-11-20 11:35:50 AM  
fizzix_is_fun

the difference in reaction between cane sugar and HFCS is what makes HFCS worse for you.
you consume more total calories without your body giving you feedback that you're full, and it actually makes you hungrier.

 
Biv 2009-11-20 11:39:08 AM  
CygnusDarius: Biv: Damn you people. It is entirely too early in the day to be thinking about corn on the cob.

You know what that means? After work, go buy corn.


That doesn't help me now.

Nothing can help me now.

 
imanadikt 2009-11-20 11:39:15 AM  
Just waking up but this reminds of a an idea I've been too lazy to check on -

What exactly makes corn kernels pop into popcorn? Just plain heat?

Why can't we do the same thing with marijuana seeds? I've tried the microwave, doesn't work.

\sleepy
\\need coffee

 
T.O.mathews 2009-11-20 11:41:48 AM  
*From the last paragraph of the article*
The genome of the world's most widely eaten plant, rice, was sequenced several years ago. Sorghum, tomato, potato, pepper and soybean sequencing is underway.


This just proves that in the next 20 years we will have the most perfect thanksgiving dinners possible because only perfect vegetables will be grown!!!

/In FEBRUARY!

 
Tainted1 2009-11-20 11:49:44 AM  
That's amaizing!!!

 
Displayed 50 of 63 comments

First | « | 1 | 2 | » | Last | Show all


This thread is closed to new comments.

[Continue Farking]