If you can read this, either the style sheet didn't load or you have an older browser that doesn't support style sheets. Try clearing your browser cache and refreshing the page.
Fark SearchWeb Fark

         more options... Create account

(io9) Cool Denis Leary thinks that Gattaca will make a great TV series, so he's got his production company working on it   (io9.com) divider line 56
More: Cool, Denis Leary, science fiction movies, NCIS, Graeme McMillan, production company, Syfy, trade paper, TV series  
•       •       •

3371 clicks; posted to Showbiz » on 01 Nov 2009 at 3:23 AM   |  Make this a Fark FavoriteFavorite    |   share: Share on OMGTWITTER WEB2.0share on StumbleUponshare on Facebook  more»   |    Get this fabulous T-Shirt and impress the methane out of your friends! shirt it!

56 Comments   (+0 »)


First | « | 1 | 2 | » | Last | Show all
 
awfulperson [TotalFark] 2009-10-31 11:14:32 PM  
Didn't Bill Hicks pitch Gattaca as a TV series?

 
Fark It [TotalFark] 2009-10-31 11:56:41 PM  
That actually sounds very cool, but they would have to keep the "period" design elements of the movie, and not try to dumb it down for the average viewer. Think science-fiction Mad Men with a dose of noir. Although those two by themselves never bode well for television ratings....

 
Sun God [TotalFark] 2009-10-31 11:59:50 PM  
awfulperson: Didn't Bill Hicks pitch Gattaca as a TV series?

Cytosine needed!

 
jake_lex [TotalFark] 2009-11-01 12:04:29 AM  
awfulperson: Didn't Bill Hicks pitch Gattaca as a TV series?

No, but I do wish that "Let's Hunt and Kill Billy Ray Cyrus" had worked out.

 
Kliffoth [TotalFark] 2009-11-01 12:12:08 AM  
awfulperson: Didn't Bill Hicks pitch Gattaca as a TV series?

You win sir.fark that hack Leary.

 
GAT_00 [TotalFark] 2009-11-01 12:51:13 AM  
I'd watch that. Sounds fun.

awfulperson: Didn't Bill Hicks pitch Gattaca as a TV series?

That took me a second, and then I laughed a lot.

 
Tr0mBoNe [TotalFark] 2009-11-01 01:11:20 AM  
That movie presented a concept that fit perfectly in one movie with little no thought of loose ends. A show built on that concept will only fail to meet our high expectations.

 
FuturePastNow [TotalFark] 2009-11-01 01:21:37 AM  
It would make a boring TV series.

 
shivashakti [TotalFark] 2009-11-01 01:57:05 AM  
awfulperson: Didn't Bill Hicks pitch Gattaca as a TV series?

Hahaha! Nice! Well-played.

 
codewerdna 2009-11-01 03:26:43 AM  
I dunno, it could be ok.

 
aden_nak [TotalFark] 2009-11-01 03:45:07 AM  
If they try to draw the general plot of the movie out over the course of an entire season, it will be a boring flop. If they do something interesting with it (like not make it all about one crime investigation, or really explore the concepts of identity and human value) then there could be some serious merit there.

It just depends on how talented the writers and cast are.

 
MadSkillz 2009-11-01 03:48:38 AM  
I believe, like Trombone, the concept fit perfectly within the confines of a movie. The message was strong in regards to the writer's opinion of genetic engineering in our future.

A TV series based on it, would probably push that same message every week and throw in a lot of melodrama. If Leary is writing for it, it'll bludgeon the viewer repeatedly and perpetually (well, until it's cancelled)

 
IAmSuperBeast 2009-11-01 03:57:05 AM  
Kliffoth

awfulperson: Didn't Bill Hicks pitch Gattaca as a TV series?

You win sir.fark that hack Leary.


Y'know, right or wrong, there's 2 sides to every opinion. I happen to be standing on the "GOD DAMMIT BILL HICKS WASNT THAT FARKING FUNNY" side. Did Leary rip off his act? Yup. And he did it better. THERE, I SAID IT!

 
lordargent 2009-11-01 04:25:26 AM  
Tr0mBoNe: That movie presented a concept that fit perfectly in one movie with little no thought of loose ends. A show built on that concept will only fail to meet our high expectations.

Didn't they already make a series though? Battlestar Gattaca?

Where the super engineered humans were trying to wipe out the regular humans in space?

 
soj4life 2009-11-01 04:57:25 AM  
but i liked that movie, a tv series will kill it.

also, how would you make it a tv series anyway? space travel in the future, yeah it is called star trek.

 
Donnchadha [TotalFark] 2009-11-01 05:14:03 AM  
www3.timeoutny.com

Gattaca! Gattaca! Gattaca!

 
OnmyojiOmn 2009-11-01 06:10:24 AM  
IAmSuperBeast: I happen to be standing on the "GOD DAMMIT BILL HICKS WASNT THAT FARKING AT ALL FUNNY" side. Did Leary rip off his act come up with the same act at around the same time, and become more famous because his delivery was much better? Yup.

FTFY.

/If Hicks was alive he'd be still be a nobody

 
Uncle Wiggly 2009-11-01 06:17:28 AM  
Reality TV 2018

 
Ed Grubermann [TotalFark] 2009-11-01 06:33:48 AM  
Yay. A TV series based on a movie that makes Waiting For Godot feel like a blockbuster action movie. I can hardly wait.

Interesting concept, worthless execution.

 
Mart Laar's beard shaver 2009-11-01 08:12:11 AM  
This world needs less Gattica, and more Galactica.

 
Tr0mBoNe [TotalFark] 2009-11-01 08:48:14 AM  
lordargent: Tr0mBoNe: That movie presented a concept that fit perfectly in one movie with little no thought of loose ends. A show built on that concept will only fail to meet our high expectations.

Didn't they already make a series though? Battlestar Gattaca?

Where the super engineered humans were trying to wipe out the regular humans in space?


*golf clap*

 
Chris4549 2009-11-01 08:58:34 AM  
I'm not optimistic about a TV series but the movie was really, really underrated. Maybe the most underrated sci-fi movie of all time.

 
shoegaze99 2009-11-01 09:10:56 AM  
Tr0mBoNe: That movie presented a concept that fit perfectly in one movie with little no thought of loose ends. A show built on that concept will only fail to meet our high expectations.

This.

Gattaca is one of my favorite genre films of all time, a thoughtful and smart flick the likes of which they make far too infrequently.

Steal some ideas for a TV show, sure, but please don't call it Gattaca.

 
Dwight_Yeast 2009-11-01 09:14:59 AM  
They should cast Gore Vidal (as a connection to the original) and then just make the show two hours of Vidal and Leary shouting at each other.

I'd pay to watch that.

 
SharkTrager 2009-11-01 09:49:56 AM  
Tr0mBoNe: That movie presented a concept that fit perfectly in one movie with little no thought of loose ends. A show built on that concept will only fail to meet our high expectations.

Consider this. A series where every episode or string of episodes follows someone else using a borrowed ladder. It could be interesting, especially if done by Showtime, HBO, AMC or maybe FX.

 
Tr0mBoNe [TotalFark] 2009-11-01 09:58:41 AM  
SharkTrager: Tr0mBoNe: That movie presented a concept that fit perfectly in one movie with little no thought of loose ends. A show built on that concept will only fail to meet our high expectations.

Consider this. A series where every episode or string of episodes follows someone else using a borrowed ladder. It could be interesting, especially if done by Showtime, HBO, AMC or maybe FX.


Yeah. That'll never get old.

 
karasoth 2009-11-01 10:11:27 AM  
I totally would be down with this

 
RealityChuck 2009-11-01 10:11:41 AM  
Gattaca was dumb to begin with. Everything about it was poorly thought out and logically inconsistent. It's a movie that makes you think -- as long as you don't think about the movie.

 
IQ7ZuuIU 2009-11-01 10:33:09 AM  
jake_lex: awfulperson: Didn't Bill Hicks pitch Gattaca as a TV series?

No, but I do wish that "Let's Hunt and Kill Billy Ray Cyrus" had worked out.


I do not know what year Bill Hicks said that, but if his plan was carried out in a timely fashion, it may have saved us a lot of pain and suffering.

 
Lampmonster [TotalFark] 2009-11-01 10:42:28 AM  
Did I ever tell you about my son Jerome?


Watched my dvd last night. God what a great movie.

 
WhileAmericaBurns 2009-11-01 10:45:12 AM  
I don't know if there's any truth to the rumors that Leary ripped off Hicks. However, it certainly is suspicious that he hasn't done stand-up in, what, ten years, and has basically re-invented himself as a dramedy actor.

 
dstrick44 2009-11-01 10:59:19 AM  
By the time it hits TEEVEE it'll be a documentary.

 
BigG 2009-11-01 11:02:23 AM  
RealityChuck: Gattaca was dumb to begin with. Everything about it was poorly thought out and logically inconsistent. It's a movie that makes you think -- as long as you don't think about the movie.

That link contains a piss-poor* critique of the movie, missing most of the point of the movie it seems. biatching about the records of the car accident, or the nature of human societal behavior is particularly idiotic.

(* may or may not be my own piss)

 
solcofn [TotalFark] 2009-11-01 11:04:30 AM  
www.indiancomedian.com

"I have a scoop for you. I stole his (Leary's) act. I camouflaged it with punchlines, and to really throw people off, I did it before he did."


/RIP funnyman.


 
tedbundee 2009-11-01 11:14:31 AM  
awfulperson: Didn't Bill Hicks pitch Gattaca as a TV series?

Came here for this.

 
shoegaze99 2009-11-01 11:21:47 AM  
WhileAmericaBurns: However, it certainly is suspicious that he hasn't done stand-up in, what, ten years, and has basically re-invented himself as a dramedy actor.

Yes, how very suspicious. It's highly unusual for someone who started in comedy to move towards more dramatic roles as they get older. Practically unheard of.

 
John Buck 41 2009-11-01 11:26:35 AM  
Hey Denis----how about you get farking Rescue Me back on track first, before you start farking around with a new project?

//disgruntled RM fan

 
Uchiha_Cycliste [TotalFark] 2009-11-01 11:53:37 AM  
I think this could COULD be a great show if it's a true sci-fi show. If in every episode they explore some of the consequences and scenarios of living in a world like that. What are the common issues. What things happen that question the statuesque. What issues do common people have to deal with daily? We are inching towards that world... make the show a warning for why we shouldn't continue.

 
t3knomanser 2009-11-01 12:17:45 PM  
Uchiha_Cycliste: We are inching towards that world... make the show a warning for why we shouldn't continue.

I think that would be overly facile. I think, for the show to create honest drama, it would need to balance the dystopia with positive effects of the technology. Otherwise, it's just a simple black-hats/white-hats dynamic. Considering the positive potential for genetic manipulation, it's worth creating a world where the good and the bad mingle. If nothing else, it would have verisimilitude that the original film lacked.

 
Uchiha_Cycliste [TotalFark] 2009-11-01 12:39:03 PM  
t3knomanser: Uchiha_Cycliste: We are inching towards that world... make the show a warning for why we shouldn't continue.

I think that would be overly facile. I think, for the show to create honest drama, it would need to balance the dystopia with positive effects of the technology. Otherwise, it's just a simple black-hats/white-hats dynamic. Considering the positive potential for genetic manipulation, it's worth creating a world where the good and the bad mingle. If nothing else, it would have verisimilitude that the original film lacked.


I agree with everything you said. Upon further thought I don't think Gattaca would be that interesting. I'd much rather see how we get there. A series that precedes the movie. The political battles, the technology being used for great good and great evil, the fundamentalist Christians freaking out at what they consider man playing god, the three hundred years from today until then (number made up). How the legal, medical and educational institutions are forever changed. The global consequences of only first world nations having this technology for the first fifty years. What happens when a scientist goes too far?

 
csxtrainwreck [TotalFark] 2009-11-01 12:47:24 PM  
www.comicbookreligion.com

Answers his question.

 
Seequinn 2009-11-01 12:52:58 PM  
OnmyojiOmn
IAmSuperBeast


I'm guessing you two are from or near the East Coast?

Bill Hicks was one of the few comedians that had me in pain from laughing too much at his commentary.
I think he and Leary adopted similar comedic styles, but Leary's delivery never seemed to hit with me.

/If Hicks was alive he'd be still be a nobody

He'd be a writer and/or correspondent on The Daily Show. Or he'd be in prison for killing Dane Cook. But he'd still be well enough known to not need an /obscure tag on Fark.

 
INTERTRON 2009-11-01 01:23:02 PM  
I loved Gattaca, and I loved Blade Runner.

That's why I'm excited about Ridley Scott directing a "Brave New World" film written by Andrew Niccol.

 
SharkTrager 2009-11-01 01:30:03 PM  
Tr0mBoNe: SharkTrager: Tr0mBoNe: That movie presented a concept that fit perfectly in one movie with little no thought of loose ends. A show built on that concept will only fail to meet our high expectations.

Consider this. A series where every episode or string of episodes follows someone else using a borrowed ladder. It could be interesting, especially if done by Showtime, HBO, AMC or maybe FX.

Yeah. That'll never get old.


Every series gets old. But that concept could go all sorts of ways for a season at the least, which is something the networks I mentioned might be willing to do.

 
Nightmaretony 2009-11-01 02:17:43 PM  
We're sorry but employees with DNA sequence:

CAGCTACGATCACTGATCGATCGATCGATCCGTCATGCTAGGCATCGGCGCAGTCGTGA
ACGATCAGCTAGCGTGCGCATATCGCGAACGATGCGTACGCTGTACGGCTATCGATGCG
ACGATCGATGCGCAGTCGTGGTATCAGTCGAGCGTACGAGCGCGACTTGCTGATGCGCG
GTTGGCTGATATCGGAATCGCGACGATGCGATCTGTGGCATCACGATGCGATCGGAGTC
AGCTAGCATGATATCGACTGCGATCGACGGCTAGGCTATGCGACGATCGATCATCGATA
CAGCTACGATCACTGATCGATCGATCGATCCGTCATGCTAGGCATCGGCGCAGTCGTGA
ACGATCAGCTAGCGTGCGCATATCGCGAACGATGCGTACGCTGTACGGCTATCGATGCG
ACGATCGATGCGCAGTCGTGGTATCAGTCGAGCGTACGAGCGCGACTTGCTGATGCGCG
GTTGGCTGATATCGGAATCGCGACGATGCGATCTGTGGCATCACGATGCGATCGGAGTC
AGCTAGCATGATATCGACTGCGATCGACGGCTAGGCTATGCGACGATCGATCATCGATA
CAGCTACGATCACTGATCGATCGATCGATCCGTCATGCTAGGCATCGGCGCAGTCGTGA
ACGATCAGCTAGCGTGCGCATATCGCGAACGATGCGTACGCTGTACGGCTATCGATGCG
ACGATCGATGCGCAGTCGTGGTATCAGTCGAGCGTACGAGCGCGACTTGCTGATGCGCG
GTTGGCTGATATCGGAATCGCGACGATGCGATCTGTGGCATCACGATGCGATCGGAGTC
AGCTAGCATGATATCGACTGCGATCGACGGCTAGGCTATGCGACGATCGATCATCGATA
ACGATCGATGCGCAGTCGTGGTATCAGTCGAGCGTACGAGCGCGACTTGCTGATGCGCG
GTTGGCTGATATCGGAATCGCGACGATGCGATCTGTGGCATCACGATGCGATCGGAGTC
AGCTAGCATGATATCGACTGCGATCGACGGCTAGGCTATGCGACGATCGATCATCGATA
CAGCTACGATCACTGATCGATCGATCGATCCGTCATGCTAGGCATCGGCGCAGTCGTGA
ACGATCAGCTAGCGTGCGCATATCGCGAACGATGCGTACGCTGTACGGCTATCGATGCG
ACGATCGATGCGCAGTCGTGGTATCAGTCGAGCGTACGAGCGCGACTTGCTGATGCGCG
GTTGGCTGATATCGGAATCGCGACGATGCGATCTGTGGCATCACGATGCGATCGGAGTC
AGCTAGCATGATATCGACTGCGATCGACGGCTAGGCTATGCGACGATCGATCATCGATA
CAGCTACGATCACTGATCGATCGATCGATCCGTCATGCTAGGCATCGGCGCAGTCGTGA
ACGATCAGCTAGCGTGCGCATATCGCGAACGATGCGTACGCTGTACGGCTATCGATGCG
ACGATCGATGCGCAGTCGTGGTATCAGTCGAGCGTACGAGCGCGACTTGCTGATGCGCG
GTTGGCTGATATCGGAATCGCGACGATGCGATCTGTGGCATCACGATGCGATCGGAGTC
AGCTAGCATGATATCGACTGCGATCGACGGCTAGGCTATGCGACGATCGATCATCGATA
CAGCTACGATCACTGATCGATCGATCGATCCGTCATGCTAGGCATCGGCGCAGTCGTGA
ACGATCAGCTAGCGTGCGCATATCGCGAACGATGCGTACGCTGTACGGCTATCGATGCG
ACGATCGATGCGCAGTCGTGGTATCAGTCGAGCGTACGAGCGCGACTTGCTGATGCGCG
GTTGGCTGATATCGGAATCGCGACGATGCGATCTGTGGCATCACGATGCGATCGGAGTC
AGCTAGCATGATATCGACTGCGATCGACGGCTAGGCTATGCGACGATCGATCATCGATA
ACGATCGATGCGCAGTCGTGGTATCAGTCGAGCGTACGAGCGCGACTTGCTGATGCGCG
GTTGGCTGATATCGGAATCGCGACGATGCGATCTGTGGCATCACGATGCGATCGGAGTC
AGCTAGCATGATATCGACTGCGATCGACGGCTAGGCTATGCGACGATCGATCATCGATA

Are no longer eligible for employment due to rising health insurance costs.

 
Guntram Shatterhand 2009-11-01 03:04:15 PM  
I can see it now: the first season is basically the movie. The second season is them in space and the guy's heart condition finally causing him to die since there was a valid reason why people with bad hearts shouldn't go into space just because they don't want to. And they all die.

And Earth becomes even more restrictive as a result.

THE END.

 
sloshyj 2009-11-01 03:12:32 PM  
Here's the thing about Gattaca, the only film that Ethan Hawke has publicly admitted was conducted during severe night sweats and tremors - no one does not know the real story that led to the deaths and advanced degrees.

 
flaming99 2009-11-01 03:14:31 PM  
Guntram Shatterhand: I can see it now: the first season is basically the movie. The second season is them in space and the guy's heart condition finally causing him to die since there was a valid reason why people with bad hearts shouldn't go into space just because they don't want to. And they all die.

And Earth becomes even more restrictive as a result.


THE END.


you missed the entire point of the movie. The guy did not have a bad heart. He was determined to have a genetic predisposition to eventually developing a heart condition - as do MILLIONS of people who never end up having one. If he actually had a heart condition it would not have been much of a movie.

 
elvindeath 2009-11-01 07:43:30 PM  
Damn ... you know, that might actually be awesome. The movie was fantastically underrated. I wouldn't have given it a shot before Battlestar Galactica, but that proved edgy, thoughtful Sci-Fi could actually be done great on TV. NBC - if you're looking to reinvent yourself and actually get some viewers, take a chance on a show like this and get behind it with 1/100th of the power you put behind the Leno crap-bomb.

Oh ... and there's no point in a Gattaca thread without this:

www.mopo.ca

/ Link is hot, like Uma's ... uh .... everything.

 
kenposan 2009-11-01 09:07:49 PM  
Tr0mBoNe: That movie presented a concept that fit perfectly in one movie with little no thought of loose ends. A show built on that concept will only fail to meet our high expectations.

This. I love Gattaca, but fear any tv show would just ruin it.

 
Displayed 50 of 56 comments

First | « | 1 | 2 | » | Last | Show all


[Continue Farking]