This takes care of insurance companies using DNA to discriminate against patients, but what about patients that use their DNA to find out what diseases they are likely to get and then defraud the insurance companies? Are we ready to nationalize health care NOW???

Two fundamental human rights, protected by the Constitution, are the right to freedom of association and the right to freely enter into contract. This bill (yes, I read it) violates both of these Constitutional provisions (and the Tenth Amendment). If you don’t like the way a company does business, don’t do business with it. You can’t be discriminated against by someone you have no association with. And you can always start your own insurance company and charge everybody the same rate, regardless of risk.

spiderpaz: This takes care of insurance companies using DNA to discriminate against patients, but what about patients that use their DNA to find out what diseases they are likely to get and then defraud the insurance companies? Are we ready to nationalize health care NOW???

On the basis of that? No. How much of a risk do you think that is?

spiderpaz: what about patients that use their DNA to find out what diseases they are likely to get and then defraud the insurance companies?

Ahh, how would such a scam work? I've never known an insurance company to pay out on an illness someone might get. Nor can I ever imagine it happening.

Nabb1: spiderpaz: This takes care of insurance companies using DNA to discriminate against patients, but what about patients that use their DNA to find out what diseases they are likely to get and then defraud the insurance companies? Are we ready to nationalize health care NOW???

On the basis of that? No. How much of a risk do you think that is?

i'm more than ready to nationalize health care, and even i think that was silly.

Con_Authority: spiderpaz: what about patients that use their DNA to find out what diseases they are likely to get and then defraud the insurance companies?

Ahh, how would such a scam work?

"Hey, I carry the gene for Parkinson's. I'm not going to tell UHC and then maybe I'll get Parkinson's and fark them good!"

Yeah, sounds like a real hell of a plan.

Nabb1: "Hey, I carry the gene for Parkinson's. I'm not going to tell UHC and then maybe I'll get Parkinson's and fark them good!" Yeah, sounds like a real hell of a plan.


I think the idea is that you have insight into your family's history regarding genetic diseases, such as high rates for cancer. You then proceed to have genetic testing done to verify the presence of such genetic markers. If you do find them, you then proceed to enroll into various health care plans that have generous payouts for your disease in question.

I wouldn't go so far as to call it fraud. Rather, it is like playing the system.

submitter: Congress passes measure to ban DNA discrimination amid cries of "that's basist

Subby, you magnificent bastard! Very well done! Very clever! :D

+1

Lawmakers voted 414-1 today for the measure, approved previously by the Senate, intended to prohibit discrimination based on a genetic predisposition to disease.

The vote was unanimous in the Senate. Guess which one Congressman voted against this? That's right--Ron Paul. I haven't heard why, although I suspect it has something to do with returning to the gold standard.

RON PAUL! DON'T MAKE ME TYPE IT AGAIN AND AGAIN BECAUSE I WILL, UNTIL MY FINGERS BLEED.

semiotix: I haven't heard why, although I suspect it has something to do with returning to the gold standard.

i don't know why... i would suspect he feels this is beyond the scope of the authority of the federal government in some way. maybe he feels that the states should be given the choice of whether or not to discriminate based on genetic predisposition.

i don't know. sometimes you can peg exactly why he did something, sometimes you just sit there going "huh?"

whatever the reason, i'm sure he could probably make a decent case for it, but i'm also sure i would ultimately disagree.

it's long overdue

cue a Gattacca pic

burndtdan: maybe he feels that the states should be given the choice of whether or not to discriminate based on genetic predisposition.

Yes, it's probably something like that. Actually, I guess there's no way to know for sure how much of it was actual pre-existing principle and how much of it was "Sweet, a high profile bill I can cast the lone dissenting vote on! Reporters will be calling me for a week!" You win again, Ron Paul!

At least Russ Feingold, the Democrat who's always the "1" in "it passed the Senate 99-1," doesn't pretend not to enjoy the attention.

I think this story calls for use of the Adenine tag.

Nationalized health care may seem like a good idea and all until you realize who will be controlling it.

Do not want!

Approves.

ManosHands: Approves.

I came here to do that. Bravo.

Mr. McPeanut: I think this story calls for use of the Adenine tag.

*snerk*

I predict this will devolve into a bunch of bat guanine. It depends on everyone's comedic thymine, though. That's just because, uracil-ly bunch of folks.

/and I'm spent
//anyone got anything to say about cytosine?

ScubaDude1960: If you don't like the way a company does business, don't do business with it. You can't be discriminated against by someone you have no association with.

Ah, but if it became standard practice to discriminate based on genetics, then you wouldn't have a choice.

Preferably you'd be able to find out your odds from genetics and take actions, investments, and insurances accordingly.

What a load of horse shiat. If someone is predisposed to get cancer, why shouldn't they pay a 'high risk' rate? They're allowed to ask your family history but not your genetic history? Makes sense to me!

Whatever. It's not like insurance companies don't already have plenty of other reasons to deny coverage anyway, ranging from "pre-existing conditions" to "my ulcer's bothering me today, and I don't like the color of your mother-in-law's left eye."

Mr. McPeanut: I think this story calls for use of the Adenine tag.LOL

I came here to make a Gattaca joke, but then realized that under this law, the hardworking scientists at Jurassic Park won't be allowed to discriminate against non-dinosaur/pterasaur/pleisiosaur DNA, and will just have to breed whatever they've got lying around for DNA. Therefore I oppose this bill.

And the winner for goofiest argument against this idea is: spiderpaz

This takes care of insurance companies using DNA to discriminate against patients, but what about patients that use their DNA to find out what diseases they are likely to get and then defraud the insurance companies?


There COULD be a legitimate argument against this idea: namely, if the insurance companies were willing to give a rate break to people who don't have the nasty genetic markers. But of course they are not. What they are after is a double dip: these genetically carried diseases are already built into their rates, spread across everyone. To charge more for people who are carryhing the genes, and give no rebate to those who do not, is double dipping pure and simple. Fark them.

Shaggy_C: What a load of horse shiat. If someone is predisposed to get cancer, why shouldn't they pay a 'high risk' rate? They're allowed to ask your family history but not your genetic history? Makes sense to me!

yeah, let's see your dna, bub.

ScubaDude1960: Two fundamental human rights, protected by the Constitution, are the right to freedom of association and the right to freely enter into contract. This bill (yes, I read it) violates both of these Constitutional provisions (and the Tenth Amendment). If you don't like the way a company does business, don't do business with it. You can't be discriminated against by someone you have no association with. And you can always start your own insurance company and charge everybody the same rate, regardless of risk.

Unless of course you are a baker and the government wishes to regulate your work hours. Then you can't contract freely.

I came for the Gattaca reference and was not disappointed.

re-elect_jimmy_carter: yeah, let's see your dna, bub.

Should insurance companies be allowed to charge more for a smoker?

If they did that what would be the point of health insurance anymore? Wouldn't it just cease to exist because everyone is prone to something?

If I was told I wouldn't be covered for heart disease and cancer I'd just get a prescription, accident, and ER cost insurance and call it a day.

/that's bassist

subby, excellent work!! I bet it will be tough to reach 10% of farkers who get that headline! :)

This bill doesn't go far enough. I can just see the dating world 50 years from now: "His H76 allele is GATCGGATCCTAAGGCTTCA, you know what that means! Totally do not want."

Shaggy_C: re-elect_jimmy_carter: yeah, let's see your dna, bub.

Should insurance companies be allowed to charge more for a smoker?

we arent just talking about insurance companies.

i believe this thread will inevitably be divided between those that have seen gattica and those who havent.

re-elect_jimmy_carter: this thread will inevitably be divided between those that have seen gattica and those who havent.

Consider me firmly in the latter group.

Insurance and healthcare are not the only uses for DNA databases. Have we forgotten this already?

People fear their DNA will be used against them, and rightfully so.

Haven't read the bill, but suspect it does nothing to protect DNA records from government intrusion.

Article I Section 8 Clause 3 of the US constitution gives the federal government the power to regulate interstate and foreign commerce.

The 10th amendment states whatever is not specifically granted to the feds is a right of the state or the people.

The federal government does not have the constitutional power to do national healthcare, or many of the other things it does.

When will the sheeple wake up and stop praying that the federal government ignores more of the constitution? When are they going to say enough is enough? When are they going to hold politicians responsible for their voting record on bills?

Did you know the war on poverty has been going on since Johnson started it in 1964 and it has cost tax payers over $7,000,000,000,000? Did you know that ever since the war on poverty was declared more people have gone into poverty?

The war on drugs has a similar record. And the preamble to the drug statutes (21 USC 801 iirc) states that because some drugs are involved in interstate and foreign commerce and since congress cant tell which are and which arent they all are. A blantent modification to the powers the constitution gives the federal government without ratification - they dont have the power to do this.

Before its too late and there is nothing left use your vote to uphold the constitution, do not allow the federal government to continue to rob you of constitutional guarantees, of your hard earned money via taxes, and of the liberties that you may enjoy.

The federal government is not supposed to have any power within the state only with transactions that directly cross state lines. Remember this when you vote.

Now if only we can ban using genetics to free criminals based upon them having a genetic predisposition to committing crimes.

Nice one subby! +1

Not to present this as a GOOD example, but people still get flood insurance despite living in different risk areas, so why shouldn't they get health insurance despite having known health risks?

The way it'll work is to have everyone covered under one low cost plan and you'll have to get riders for specific things.

I've got more here if you're interested, but consider that the government is considering collecting DNA samples from anyone arrested for a crime, even misdemeanors(they'll drum up anti-immigrant sentiment and propose this as a way to control illegal immigration), and marketers really, really, want this kind of information. Take this also in context of the fact that the government is really bad at keeping information secure that hackers want. Just ask a veteran.

Can we use DNA to prevent certain people from, oh, let's say, running for President on the grounds they're really farking clueless?

Genius headline.

THAT'S a bassist. MMMmmmmm....

Shaggy_C: Consider me firmly in the latter group.

that's too bad, it's an amazing movie.

that's a fundy bassist.

grrr dropped images make me stabby

This is an Equal Protection issue, not a contracts issue. You can refuse to insure someone based on a pre-existing condition now. You don't have to offer insurance to anyone. You cannot, however, refuse to insure them because of their predisposition to certain conditions. Predisposition means you've got a faulty gene somewhere, but it doesn't ensure that you're going to have problems. Everyone has these kinds of genes, btw. I guess people just don't care unless it affects them.

This bill might just help science along and help make gene therapy treatments for certain diseases more common.

I don't see why this is so damned bad. It's a bipartisan effort. It will benefit everyone. I guess some people just like to biatch for the sake of biatching.

Insurance is intended to spread the risk. The more an insurance company knows, the less they are doing to "spread the risk" - they just allocate it to those who pose the risk.

Taken to an extreme, let us presume they can predict your entire (non-accident related) medical history. In such a case, they can just quote you the costs of the procedures + their markup. And it won't be insurance anymore!

The reason it shouldn't be permitted is because it is due to factors outside of our control. We are born with a certain DNA, and there is nothing we can do about it. We can chose to smoke or not, but we can't chose to have a faulty heart ventricle.

If you want insurance to be actually beneficial to the public - then you cannot permit over-accurate risk measurement.

THAT'S BASIST!

No, THAT'S bassist!

Whoops, let's try this again:



No, THAT'S bassist!

"Of course, it's illegal to discriminate, 'genoism' it's called. But no one takes the law seriously. If you refuse to disclose, they can always take a sample from a door handle or a handshake, even the saliva on your application form. If in doubt, a legal drug test can just as easily become an illegal peek at your future in the company."